AP3M1 (NM_207012) Human Untagged Clone

CAT#: SC308364

AP3M1 (untagged)-Human adaptor-related protein complex 3, mu 1 subunit (AP3M1), transcript variant 1



  "NM_207012" in other vectors (4)

CNY 6,750.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal AP3M1 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308364 representing NM_207012.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCCACAGTCTATTTCTCATAAACTGTTCCGGTGACATATTTCTAGAGAAGCACTGGAAGAGCGTT
GTGAGCCAGTCTGTCTGTGATTATTTCTTTGAAGCTCAAGAGAAAGCTGCTGATGTTGAAAATGTACCA
CCTGTCATTTCAACACCTCACCACTACCTCATCAGTATCTACCGGGATAAGCTCTTCTTTGTATCTGTC
ATACAGACCGAAGTGCCACCTCTCTTTGTAATTGAGTTCCTACATCGAGTTGCTGACACTTTTCAGGAC
TACTTTGGTGAGTGTTCAGAGGCTGCAATTAAGGATAATGTGGTCATAGTATATGAACTCTTAGAAGAA
ATGTTAGACAATGGATTTCCACTGGCTACCGAATCTAACATTTTGAAAGAATTGATTAAACCACCAACA
ATTCTACGCTCTGTTGTCAACTCTATTACAGGCAGTAGTAATGTTGGGGACACACTCCCCACCGGGCAG
CTGTCCAACATACCATGGCGTCGGGCAGGGGTAAAGTACACAAACAATGAAGCCTATTTTGATGTTGTT
GAAGAAATAGACGCAATTATAGATAAATCAGGATCTACAGTCTTTGCAGAAATTCAGGGGGTCATTGAT
GCTTGCATTAAACTATCTGGAATGCCTGATCTCTCCCTTTCTTTCATGAACCCTAGGCTTCTGGATGAT
GTCAGCTTTCACCCCTGCATCCGGTTCAAGCGTTGGGAATCTGAAAGAGTTTTGTCATTTATTCCTCCA
GATGGAAATTTCCGACTCATATCATACCGTGTCAGCTCACAAAATCTAGTGGCAATACCAGTGTATGTG
AAACATAGTATCAGCTTTAAGGAGAACAGTTCTTGCGGCAGATTTGATATAACAATTGGACCAAAGCAG
AATATGGGGAAAACTATTGAAGGAATTACAGTGACAGTTCACATGCCAAAAGTTGTGCTGAACATGAAC
CTGACACCCACACAAGGCAGCTATACATTTGATCCAGTCACCAAGGTACTAACATGGGATGTGGGAAAA
ATTACTCCACAAAAGCTCCCAAGTCTTAAAGGACTGGTAAATTTACAGTCTGGAGCCCCCAAACCAGAA
GAGAATCCGAGCCTCAACATACAGTTTAAGATCCAGCAGCTTGCTATTTCAGGCTTAAAAGTAAACCGT
TTGGACATGTATGGGGAGAAATATAAGCCATTTAAAGGAGTCAAATACGTCACGAAAGCTGGAAAGTTC
CAAGTGAGGACATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_207012
Insert Size 1257 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_207012.3
RefSeq Size 5287 bp
RefSeq ORF 1257 bp
Locus ID 26985
UniProt ID Q9Y2T2
Protein Pathways Lysosome
MW 46.9 kDa
Gene Summary The protein encoded by this gene is the medium subunit of AP-3, which is an adaptor-related protein complex associated with the Golgi region as well as more peripheral intracellular structures. AP-3 facilitates the budding of vesicles from the Golgi membrane, and it may directly function in protein sorting to the endosomal/lysosomal system. AP-3 is a heterotetrameric protein complex composed of two large subunits (delta and beta3), a medium subunit (mu3), and a small subunit (sigma 3). Mutations in one of the large subunits of AP-3 have been associated with the Hermansky-Pudlak syndrome, a genetic disorder characterized by defective lysosome-related organelles. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes the longer isoform (a). Variants 1, 2, 3 and 4 all encode isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...