PECI (ECI2) (NM_206836) Human Untagged Clone
CAT#: SC308278
ECI2 (untagged)-Human enoyl-CoA delta isomerase 2 (ECI2), transcript variant 2
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACBD2; dJ1013A10.3; DRS-1; DRS1; HCA88; PECI |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_206836, the custom clone sequence may differ by one or more nucleotides
ATGGCGATGGCGTACTTGGCTTGGAGACTGGCGCGGCGTTCGTGTCCGAGTTCTCTGCAG GTCACTAGTTTCCCGGTAGTTCAGCTGCACATGAATAGAACAGCAATGAGAGCCAGTCAG AAGGACTTTGAAAATTCAATGAATCAAGTGAAACTCTTGAAAAAGGATCCAGGAAACGAA GTGAAGCTAAAACTCTACGCGCTATATAAGCAGGCCACTGAAGGACCTTGTAACATGCCC AAACCAGGTGTATTTGACTTGATCAACAAGGCCAAATGGGACGCATGGAATGCCCTTGGC AGCCTGCCCAAGGAAGCTGCCAGGCAGAACTATGTGGATTTGGTGTCCAGTTTGAGTCCT TCATTGGAATCCTCTAGTCAGGTGGAGCCTGGAACAGACAGGAAATCAACTGGGTTTGAA ACTCTGGTGGTGACCTCCGAAGATGGCATCACAAAGATCATGTTCAACCGGCCCAAAAAG AAAAATGCCATAAACACTGAGATGTATCATGAAATTATGCGTGCACTTAAAGCTGCCAGC AAGGATGACTCAATCATCACTGTTTTAACAGGAAATGGTGACTATTACAGTAGTGGGAAT GATCTGACTAACTTCACTGATATTCCCCCTGGTGGAGTAGAGGAGAAAGCTAAAAATAAT GCCGTTTTACTGAGGGAATTTGTGGGCTGTTTTATAGATTTTCCTAAGCCTCTGATTGCA GTGGTCAATGGTCCAGCTGTGGGCATCTCCGTCACCCTCCTTGGGCTATTCGATGCCGTG TATGCATCTGACAGGGCAACATTTCATACACCATTTAGTCACCTAGGCCAAAGTCCGGAA GGATGCTCCTCTTACACTTTTCCGAAGATAATGAGCCCAGCCAAGGCAACAGAGATGCTT ATTTTTGGAAAGAAGTTAACAGCGGGAGAGGCATGTGCTCAAGGACTTGTTACTGAAGTT TTCCCTGATAGCACTTTTCAGAAAGAAGTCTGGACCAGGCTGAAGGCATTTGCAAAGCTT CCCCCAAATGCCTTGAGAATTTCAAAAGAGGTAATCAGGAAAAGAGAGAGAGAAAAACTA CACGCTGTTAATGCTGAAGAATGCAATGTCCTTCAGGGAAGATGGCTATCAGATGAATGC ACAAATGCTGTGGTGAACTTCTTATCCAGAAAATCAAAACTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_206836 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_206836.1, NP_996667.1 |
RefSeq Size | 1481 bp |
RefSeq ORF | 684 bp |
Locus ID | 10455 |
UniProt ID | O75521 |
Protein Pathways | Fatty acid metabolism |
Gene Summary | This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) uses an alternate upstream translational start codon and includes an alternate splice site in its 5' coding region, compared to variant 1. The encoded isoform (2) has a longer and distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201094 | ECI2 (Myc-DDK-tagged)-Human enoyl-CoA delta isomerase 2 (ECI2), transcript variant 2 |
CNY 3,990.00 |
|
RC201094L3 | Lenti-ORF clone of ECI2 (Myc-DDK-tagged)-Human enoyl-CoA delta isomerase 2 (ECI2), transcript variant 2 |
CNY 5,890.00 |
|
RC201094L4 | Lenti-ORF clone of ECI2 (mGFP-tagged)-Human enoyl-CoA delta isomerase 2 (ECI2), transcript variant 2 |
CNY 5,890.00 |
|
RG201094 | ECI2 (tGFP-tagged) - Human enoyl-CoA delta isomerase 2 (ECI2), transcript variant 2 |
CNY 4,370.00 |
|
SC320706 | ECI2 (untagged)-Human enoyl-CoA delta isomerase 2 (ECI2), transcript variant 2 |
CNY 2,400.00 |
|
SC327823 | ECI2 (untagged)-Human peroxisomal D3D2-enoyl-CoA isomerase (PECI) transcript variant 2 |
CNY 7,220.00 |