United States
Germany
Japan
United Kingdom
China
Myelin oligodendrocyte glycoprotein (MOG) (NM_206809) Human Untagged Clone
CAT＃: SC308258
MOG (untagged)-Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha1
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BTN6; BTNL11; MOGIG2; NRCLP7 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_206809, the custom clone sequence may differ by one or more nucleotides
ATGGCAAGCTTATCAAGACCCTCTCTGCCCAGCTGCCTCTGCTCCTTCCTCCTCCTCCTCCTCCTCCAAG TGTCTTCCAGCTATGCAGGGCAGTTCAGAGTGATAGGACCAAGACACCCTATCCGGGCTCTGGTCGGGGA TGAAGTGGAATTGCCATGTCGCATATCTCCTGGGAAGAACGCTACAGGCATGGAGGTGGGGTGGTACCGC CCCCCCTTCTCTAGGGTGGTTCATCTCTACAGAAATGGCAAGGACCAAGATGGAGACCAGGCACCTGAAT ATCGGGGCCGGACAGAGCTGCTGAAAGATGCTATTGGTGAGGGAAAGGTGACTCTCAGGATCCGGAATGT AAGGTTCTCAGATGAAGGAGGTTTCACCTGCTTCTTCCGAGATCATTCTTACCAAGAGGAGGCAGCAATG GAATTGAAAGTAGAAGATCCTTTCTACTGGGTGAGCCCTGGAGTGCTGGTTCTCCTCGCGGTGCTGCCTG TGCTCCTCCTGCAGATCACTGTTGGCCTCATCTTCCTCTGCCTGCAGTACAGACTGAGAGGAAAACTTCG AGCAGAGATAGAGAATCTCCACCGGACTTTTGATCCCCACTTTCTGAGGGTGCCCTGCTGGAAGATAACC CTGTTTGTAATTGTGCCGGTTCTTGGACCCTTGGTTGCCTTGATCATCTGCTACAACTGGCTACATCGAA GACTAGCAGGGCAATTCCTTGAAGAGCTACGAAATCCCTTCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_206809 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_206809.2, NP_996532.2 |
| RefSeq Size | 2119 bp |
| RefSeq ORF | 744 bp |
| Locus ID | 4340 |
| UniProt ID | Q16653 |
| Protein Families | Transmembrane |
| Gene Summary | The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (alpha1) contains an additional segment in the coding region compared to variant beta1. Alpha type variants use an alternative splice site at the 3' end, compared to variant beta1. The resulting isoform (alpha1), also known as isoform 2, contains a shorter and distinct C-terminus compared to isoform beta1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222455 | MOG (Myc-DDK-tagged)-Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha1 |
CNY 2,400.00 |
|
| RC222455L3 | Lenti ORF clone of Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC222455L4 | Lenti ORF clone of Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha1, mGFP tagged |
CNY 4,800.00 |
|
| RG222455 | MOG (tGFP-tagged) - Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha1 |
CNY 4,000.00 |
其它Myelin oligodendrocyte glycoprotein产品
