Neuromedin B (NMB) (NM_205858) Human Untagged Clone
CAT#: SC308246
NMB (untagged)-Human neuromedin B (NMB), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308246 representing NM_205858.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCGGCGGGCGGGGGGCGCTCGGATGTTCGGCAGCCTCCTGCTCTTCGCCCTGCTCGCTGCCGGC GTCGCCCCGCTCAGCTGGGATCTCCCGGAGCCCCGCAGCCGAGCCAGCAAGATCCGAGTGCACTCGCGA GGCAACCTCTGGGCCACCGGTCACTTCATGGGCAAGAAGAGTCTGGAGCCTTCCAGCCCATCCCCATTG GGGACAGCTCCCCACACCTCCCTGAGGGACCAGCGACTGCAGCTGAGTCATGATCTGCTCGGAATCCTC CTGCTAAAGAAGGCTCTGGGCGTGAGCCTCAGCCGCCCCGCACCCCAAATCCAGGAGGCTGCTGGTACA AATACTGCAGAAATGACACCAATAATGGGGCAGACACAACAGCGTGGCTTAGATTGTGCCCACCCAGGG AAGGTGCTGAATGGGACCCTGTTGATGGCCCCATCTGGATGTAAATCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_205858 |
Insert Size | 465 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_205858.1 |
RefSeq Size | 1041 bp |
RefSeq ORF | 465 bp |
Locus ID | 4828 |
UniProt ID | P08949 |
Protein Families | Secreted Protein, Transmembrane |
MW | 16.3 kDa |
Gene Summary | This gene encodes a member of the bombesin-like family of neuropeptides, which negatively regulate eating behavior. The encoded protein may regulate colonic smooth muscle contraction through binding to its cognate receptor, the neuromedin B receptor (NMBR). Polymorphisms of this gene may be associated with hunger, weight gain and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a longer and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213833 | NMB (Myc-DDK-tagged)-Human neuromedin B (NMB), transcript variant 2 |
CNY 1,200.00 |
|
RC213833L3 | Lenti ORF clone of Human neuromedin B (NMB), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213833L4 | Lenti ORF clone of Human neuromedin B (NMB), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG213833 | NMB (tGFP-tagged) - Human neuromedin B (NMB), transcript variant 2 |
CNY 2,800.00 |
其它Neuromedin B产品