CLEC4C (NM_203503) Human Untagged Clone
CAT#: SC308216
CLEC4C (untagged)-Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BDCA-2; BDCA2; CD303; CLECSF7; CLECSF11; DLEC; HECL; PRO34150 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308216 representing NM_203503.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGCCTGAAGAAGAGCCTCAAGACCGAGTGCCTCACAATTTTATGTATAGCAAAACTGTCAAGAGG CTGTCCAAGTTACGAGAGTATCAACAGTATCATCCAAGCCTGACCTGCGTCATGGAAGGAAAGGACATA GAAGATTGGAGCTGCTGCCCAACCCCTTGGACTTCATTTCAGTCTAGTTGCTACTTTATTTCTACTGGG ATGCAATCTTGGACTAAGAGTCAAAAGAACTGTTCTGTGATGGGGGCTGATCTGGTGGTGATCAACACC AGGGAAGAACAGGATTTCATCATTCAGAATCTGAAAAGAAATTCTTCTTATTTTCTGGGGCTGTCAGAT CCAGGGGGTCGGCGACATTGGCAATGGGTTGACCAGACACCATACAATGAAAATGTCACATTCTGGCAC TCAGGTGAACCCAATAACCTTGATGAGCGTTGTGCGATAATAAATTTCCGTTCTTCAGAAGAATGGGGC TGGAATGACATTCACTGTCATGTACCTCAGAAGTCAATTTGCAAGATGAAGAAGATCTACATATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_203503 |
Insert Size | 549 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_203503.1 |
RefSeq Size | 1221 bp |
RefSeq ORF | 549 bp |
Locus ID | 170482 |
UniProt ID | Q8WTT0 |
Protein Families | Druggable Genome, Transmembrane |
MW | 21.5 kDa |
Gene Summary | This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in dendritic cell function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2), also known as DLEC-beta, lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211470 | CLEC4C (Myc-DDK-tagged)-Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 2 |
CNY 2,400.00 |
|
RC211470L1 | Lenti ORF clone of Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC211470L2 | Lenti ORF clone of Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC211470L3 | Lenti ORF clone of Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211470L4 | Lenti ORF clone of Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG211470 | CLEC4C (tGFP-tagged) - Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 2 |
CNY 4,370.00 |