United States
Germany
Japan
United Kingdom
China
LGALS14 (NM_203471) Human Untagged Clone
CAT＃: SC308200
LGALS14 (untagged)-Human lectin, galactoside-binding, soluble, 14 (LGALS14), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CLC2; PPL13 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_203471 edited
ATGTCCCTGACCCACAGGCTTCATTTGTGCAAGTACTGGGGCTGTGCTGTCAGTAATGTG TGCCGCTTCTGGGAAGGACGTCCATTGCCCTTGATGATTGTGGTACCATACACACTGCCT GTTTCCTTGCCTGTTGGTTCGTGCGTGATAATCACAGGGACACCGATCCTCACTTTTGTC AAGGACCCACAGCTGGAGGTGAATTTCTACACTGGGATGGATGAGGACTCAGATATTGCT TTCCAATTCCGACTGCACTTTGGTCATCCTGCAATCATGAACAGTTGTGTGTTTGGCATA TGGAGATATGAGGAGAAATGCTACTATTTACCCTTTGAAGATGGCAAACCATTTGAGCTG TGCATCTATGTGCGTCACAAGGAATACAAGGTAATGGTAAATGGCCAACGCATTTACAAC TTTGCCCATCGATTCCCGCCAGCATCTGTGAAGATGCTGCAAGTCTTCAGAGATATCTCC CTGACCAGAGTGCTTATCAGCGATTGAGGGAGATGATCAGACTCCTCATTGTTGAGGAAT CCCTCTTTCTACCTGACCATGGGATTCCCAGAGCCTACTAACAGAATAATCCCTCCTCAC CCCTTCCCCTACACTTGATCATTAAAACAGCACCAAACCTCAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_203471 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_203471.1, NP_982297.1 |
| RefSeq Size | 1099 bp |
| RefSeq ORF | 507 bp |
| Locus ID | 56891 |
| UniProt ID | Q8TCE9 |
| Protein Families | Transmembrane |
| Gene Summary | This gene is predominantly expressed in placenta. The encoded protein belongs to the galectin (galaptin/S-lectin) family. The members of galectin family contain one or two carbohydrate recognition domains, which can bind beta-galactoside. Two alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) encodes the longer isoform (2). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215668 | LGALS14 (Myc-DDK-tagged)-Human lectin, galactoside-binding, soluble, 14 (LGALS14), transcript variant 2 |
CNY 3,990.00 |
|
| RC215668L3 | Lenti-ORF clone of LGALS14 (Myc-DDK-tagged)-Human lectin, galactoside-binding, soluble, 14 (LGALS14), transcript variant 2 |
CNY 5,890.00 |
|
| RC215668L4 | Lenti-ORF clone of LGALS14 (mGFP-tagged)-Human lectin, galactoside-binding, soluble, 14 (LGALS14), transcript variant 2 |
CNY 5,890.00 |
|
| RG215668 | LGALS14 (tGFP-tagged) - Human lectin, galactoside-binding, soluble, 14 (LGALS14), transcript variant 2 |
CNY 4,370.00 |
其它LGALS14产品
