United States
Germany
Japan
United Kingdom
China
Calcipressin 1 (RCAN1) (NM_203417) Human Untagged Clone
CAT＃: SC308168
RCAN1 (untagged)-Human regulator of calcineurin 1 (RCAN1), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ADAPT78; CSP1; DSC1; DSCR1; MCIP1; RCN1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC308168 representing NM_203417.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGTTATATTTTGCTCAGACCTTACACATAGGAAGCTCACACCTGGCTCCGCCAAATCCAGACAAG CAGTTTCTGATCTCCCCTCCCGCCTCTCCGCCAGTGGGATGGAAACAAGTGGAAGATGCGACCCCAGTC ATAAACTATGATCTCTTATATGCCATCTCCAAGCTGGGGCCAGGGGAAAAGTATGAATTGCACGCAGCG ACTGACACCACTCCCAGCGTGGTGGTCCATGTATGTGAGAGTGATCAAGAGAAGGAGGAAGAAGAGGAA ATGGAAAGAATGAGGAGACCTAAGCCAAAAATTATCCAGACCAGGAGGCCGGAGTACACGCCGATCCAC CTCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_203417 |
| Insert Size | 354 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_203417.2 |
| RefSeq Size | 2322 bp |
| RefSeq ORF | 354 bp |
| Locus ID | 1827 |
| UniProt ID | P53805 |
| Protein Families | Transcription Factors |
| MW | 13.3 kDa |
| Gene Summary | The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (2) uses an alternate 5' exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202391 | RCAN1 (Myc-DDK-tagged)-Human regulator of calcineurin 1 (RCAN1), transcript variant 2 |
CNY 2,400.00 |
|
| RC202391L1 | Lenti ORF clone of Human regulator of calcineurin 1 (RCAN1), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC202391L2 | Lenti ORF clone of Human regulator of calcineurin 1 (RCAN1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC202391L3 | Lenti ORF clone of Human regulator of calcineurin 1 (RCAN1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202391L4 | Lenti ORF clone of Human regulator of calcineurin 1 (RCAN1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG202391 | RCAN1 (tGFP-tagged) - Human regulator of calcineurin 1 (RCAN1), transcript variant 2 |
CNY 4,000.00 |
其它Calcipressin 1产品
