Stathmin 1 (STMN1) (NM_203399) Human Untagged Clone
CAT#: SC308155
STMN1 (untagged)-Human stathmin 1 (STMN1), transcript variant 2
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1orf215; Lag; LAP18; OP18; PP17; PP19; PR22; SMN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308155 representing NM_203399.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATT CTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATCTTTCC CTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTG AAGCAGCTGGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAAC TTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAA ATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAAGAACAAAGAA TCCAAAGACCCTGCTGACGAGACTGAAGCTGACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_203399 |
Insert Size | 450 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_203399.1 |
RefSeq Size | 1518 bp |
RefSeq ORF | 450 bp |
Locus ID | 3925 |
UniProt ID | P16949 |
Protein Pathways | MAPK signaling pathway |
MW | 17.3 kDa |
Gene Summary | This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate terminal exon, compared to variant 4. The resulting isoform (a) has a shorter and distinct C-terminus, compared to isoform b. Variants 1, 2, and 3 encode the same protein. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
The 1p-encoded protein stathmin and resistance of malignant gliomas to nitrosoureas
,TT Ngo, T Peng, XJ Liang, O Akeju, S Pastorino, W Zhang, Y Kotliarov, JC Zenklusen, HA Fine, D Maric, PY Wen, U De Girolami, PM Black, WW Wu, RF Shen, NO Jeffries, DW Kang, and JK Park,
J Natl Cancer Inst. 2007 Apr 18;99(8):639-52.
[STMN1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220276 | STMN1 (Myc-DDK-tagged)-Human stathmin 1 (STMN1), transcript variant 2 |
CNY 1,200.00 |
|
RC220276L3 | Lenti ORF clone of Human stathmin 1 (STMN1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220276L4 | Lenti ORF clone of Human stathmin 1 (STMN1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG220276 | STMN1 (tGFP-tagged) - Human stathmin 1 (STMN1), transcript variant 2 |
CNY 2,800.00 |
其它Stathmin 1产品