Myoglobin (MB) (NM_203377) Human Untagged Clone

CAT#: SC308144

MB (untagged)-Human myoglobin (MB), transcript variant 2



  "NM_203377" in other vectors (4)

CNY 3,990.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MB Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PVALB
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_203377, the custom clone sequence may differ by one or more nucleotides


ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCAG
GCCATGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACTTAAAGAAGCATGGTGCCACCGTGCTC
ACCGCCCTGGGTGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAGTCGC
ATGCCACCAAGCACAAGATCCCCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCTGCA
GAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG


Restriction Sites NotI-NotI     
ACCN NM_203377
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found two SNPs within the protein associated with this reference, NM_203377.1. These two SNPs don't change amino acid.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_203377.1, NP_976311.1
RefSeq Size 1170 bp
RefSeq ORF 465 bp
Locus ID 4151
UniProt ID P02144
Gene Summary This gene encodes a member of the globin superfamily and is predominantly expressed in skeletal and cardiac muscles. The encoded protein forms a monomeric globular haemoprotein that is primarily responsible for the storage and facilitated transfer of oxygen from the cell membrane to the mitochondria. This protein also plays a role in regulating physiological levels of nitric oxide. Multiple transcript variants encoding distinct isoforms exist for this gene. [provided by RefSeq, May 2020]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1-4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...