ZCCHC13 (NM_203303) Human Untagged Clone

CAT#: SC308112

ZCCHC13 (untagged)-Human zinc finger, CCHC domain containing 13 (ZCCHC13)



  "NM_203303" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ZCCHC13 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CNBP2; ZNF9L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308112 representing NM_203303.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCAGTAAGGATTTCTTCGCGTGTGGACACTCTGGCCATTGGGCTCGGGGATGCCCTAGAGGAGGA
GCTGGAGGGCGAAGAGGTGGAGGCCATGGCAGAGGTTCTCAATGTGGTTCCACCACCCTATCTTACACC
TGTTACTGCTGTGGTGAGTCCGGTCGTAATGCTAAGAACTGTGTCCTTCTCGGAAACATCTGCTACAAC
TGTGGGAGAAGCGGCCACATCGCCAAAGACTGTAAGGATCCTAAACGAGAGAGACGCCAACACTGTTAT
ACCTGCGGCAGACTAGGACATCTGGCTCGTGACTGTGATCGTCAGAAAGAGCAGAAATGCTACTCTTGC
GGCAAACTTGGGCACATTCAGAAAGACTGCGCCCAGGTCAAGTGTTACCGATGCGGCGAGATTGGCCAC
GTGGCCATCAATTGCAGCAAGGCGAGGCCAGGTCAACTGCTACCGCTGCGGCAAATCCCGACATCTAGC
CAAGGAATGTCCCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_203303
Insert Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_203303.2
RefSeq Size 859 bp
RefSeq ORF 501 bp
Locus ID 389874
UniProt ID Q8WW36
MW 18 kDa
Gene Summary This gene appears to represent an intronless retrocopy of a related multi-exon gene located on chromosome 3. However, the CDS of this intronless gene remains relatively intact, it is conserved in other mammalian species, it is known to be transcribed, and it is therefore thought to encode a functional protein. The encoded protein contains six CCHC-type zinc fingers, and is thus thought to function as a transcription factor. [provided by RefSeq, May 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...