EGFL7 (NM_201446) Human Untagged Clone
CAT#: SC308036
EGFL7 (untagged)-Human EGF-like-domain, multiple 7 (EGFL7), transcript variant 2
CNY 2,400.00
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NEU1; VE-STATIN; ZNEU1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC114429 sequence for NM_016215 edited (data generated by NextGen Sequencing)
ATGAGGGGCTCTCAGGAGGTGCTGCTGATGTGGCTTCTGGTGTTGGCAGTGGGCGGCACA GAGCACGCCTACCGGCCCGGCCGTAGGGTGTGTGCTGTCCGGGCTCACGGGGACCCTGTC TCCGAGTCGTTCGTGCAGCGTGTGTACCAGCCCTTCCTCACCACCTGCGACGGGCACCGG GCCTGCAGCACCTACCGAACCATCTATAGGACCGCCTACCGCCGCAGCCCTGGGCTGGCC CCTGCCAGGCCTCGCTACGCGTGCTGCCCCGGCTGGAAGAGGACCAGCGGGCTTCCTGGG GCCTGTGGAGCAGCAATATGCCAGCCGCCATGCCGGAACGGAGGGAGCTGTGTCCAGCCT GGCCGCTGCCGCTGCCCTGCAGGATGGCGGGGTGACACTTGCCAGTCAGATGTGGATGAA TGCAGTGCTAGGAGGGGCGGCTGTCCCCAGCGCTGCGTCAACACCGCCGGCAGTTACTGG TGCCAGTGTTGGGAGGGGCACAGCCTGTCTGCAGACGGTACACTCTGTGTGCCCAAGGGA GGGCCCCCCAGGGTGGCCCCCAACCCGACAGGAGTGGACAGTGCAATGAAGGAAGAAGTG CAGAGGCTGCAGTCCAGGGTGGACCTGCTGGAGGAGAAGCTGCAGCTGGTGCTGGCCCCA CTGCACAGCCTGGCCTCGCAGGCACTGGAGCATGGGCTCCCGGACCCCGGCAGCCTCCTG GTGCACTCCTTCCAGCAGCTCGGCCGCATCGACTCCCTGAGCGAGCAGATTTCCTTCCTG GAGGAGCAGCTGGGGTCCTGCTCCTGCAAGAAAGACTCGTGA Clone variation with respect to NM_016215.4 |
Restriction Sites | Please inquire |
ACCN | NM_201446 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_201446.1, NP_958854.1 |
RefSeq Size | 1571 bp |
RefSeq ORF | 822 bp |
Locus ID | 51162 |
UniProt ID | Q9UHF1 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218903 | EGFL7 (Myc-DDK-tagged)-Human EGF-like-domain, multiple 7 (EGFL7), transcript variant 2 |
CNY 2,400.00 |
|
RC218903L3 | Lenti ORF clone of Human EGF-like-domain, multiple 7 (EGFL7), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218903L4 | Lenti ORF clone of Human EGF-like-domain, multiple 7 (EGFL7), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG218903 | EGFL7 (tGFP-tagged) - Human EGF-like-domain, multiple 7 (EGFL7), transcript variant 2 |
CNY 4,370.00 |