UQCC (UQCC1) (NM_199487) Human Untagged Clone

CAT#: SC307991

UQCC (untagged)-Human ubiquinol-cytochrome c reductase complex chaperone (UQCC), nuclear gene encoding mitochondrial protein, transcript variant 2



  "NM_199487" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-UQCC Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BFZB; C20orf44; CBP3; UQCC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307991 representing NM_199487.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGTTGCTGGTGCGAGTCCTTAGGAACCAGACTAGCATTTCTCAGTGGGTTCCAGTATGCAGCCGA
TTGATACCTGTGTCTCCTACCCAAGGACAGGGGGACAGGGCTCTGTCTCGCACTTCCCAGTGGCCCCAG
ATGAGCCAGTCCCGAGCATGTGGTGGATCAGAACAGATTCCTGGAATAGACATACAGCTGAATAGGAAG
TATCACACCACACGTAAGCTTTCTACTACCAAAGATTCCCCACAGCCTGTTGAGGAGAAGGTTGGTGCT
TTCACAAAGATAATAGAAGCCATGGGATTCACGGGACCTTTGAAATACAGTAAATGGAAGATTAAGATT
GCGGCCCTGCGCATGTATACTAGCTGTGTGGAGAAAACTGACTTCGAGGAATTCTTTCTAAGGTGTCAG
ATGCCTGATACATTCAATTCATGGTTTCTTATAACCCTACTCCACGTCTGGATGTGTCTAGTCCGAATG
AAGCAGGAAGGCCGGAGTGGGAAGTACATGTGTCGTATCATAGTTCATTTTATGTGGGAGGATGTTCAG
CAGCGCGGCAGAGTCATGGGGGGGATCCTTTCAGATGATCATGGGCTGGCCGCTGCCCTCTGGAGAACC
TTCTTCAACCGGAAATGTGAAGACCCTCGACATCTTGAATTGCTGGTAGAGTATGTGAGGAAACAGATA
CAGTACCTGGACTCCATGAACGGGGAGGATCTGCTTCTGACAGGGGAGGTGAGCTGGCGCCCTCTAGTG
GAGAAGAATCCTCAGAGCATCCTGAAGCCCCATTCTCCGACTTACAACGACGAGGGACTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_199487
Insert Size 822 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_199487.2
RefSeq Size 2383 bp
RefSeq ORF 822 bp
Locus ID 55245
UniProt ID Q9NVA1
MW 31.5 kDa
Gene Summary This gene encodes a transmembrane protein that is structurally similar to the mouse basic fibroblast growth factor repressed ZIC-binding protein. In mouse this protein may be involved in fibroblast growth factor regulated growth control. In humans, polymorphisms in this gene are associated with variation in human height and osteoarthritis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (2) lacks an in-frame exon compared to variant 1. The resulting isoform (b) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...