ZNF365 (NM_199450) Human Untagged Clone

CAT#: SC307980

ZNF365 (untagged)-Human zinc finger protein 365 (ZNF365), transcript variant B



  "NM_199450" in other vectors (4)

CNY 5,420.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ZNF365 mouse monoclonal antibody, clone OTI1B7 (formerly 1B7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Su48; UAN; ZNF365D
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307980 representing NM_199450.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAACAGAAGGCTTTTGAGGAAAGCAGATATCCCTGGCAGGAGTCCTTTGAGAATGTTGCTGTGTGC
CTGCCATTACGCTGCCCGAGGTGTGGAGACCATACCAGATTTAGAAGCTTGTCATCCTTGAGGGCCCAT
CTGGAGTTCAGTCACAGCTACGAAGAAAGAACCCTCTTGACAAAATGCAGTCTCTTTCCATCCCTCAAA
GACACAGACCTAGTCACTTCCTCAGAACTCCTGAAACCGGGAAAATTGCAGAGCAGTGGCAACGTGGTA
AAGCAGAAACCGAGCTATGTTAACTTGTACAGCATTTCACATGAACATTCCAAGGACAGGAAGCCATTT
GAGGTGGTGGCAGAGAGGCCTGTGTCCTATGTGCAGACCTACACTGCCATGGACCTCCATGCAGACTCG
CTGGATGGGACACGGTCGGGTCCTGGACTGCCCACCTCAGACACCAAAGCTTCTTTCGAGGCACATGTC
AGAGAAAAATTCAATCGAATGGTTGAGGCTGTGGATAGGACCATTGAGAAGAGAATTGATAAACTCACC
AAAGAGTTGGCCCAGAAAACTGCGGAACTGTTGGAAGTTCGGGCAGCTTTTGTGCAGCTGACTCAGAAA
AAGCAGGAAGTTCAGAGACGAGAGCGGGCCTTAAACAGACAGGTGGACGTGGCCGTGGAAATGATAGCT
GTACTGAGGCAACGCCTGACGGAATCTGAGGAGGAGCTTCTTAGGAAAGAAGAAGAAGTTGTCACATTC
AACCATTTCCTGGAAGCGGCAGCTGAGAAGGAGGTTCAAGGGAAAGCCCGGCTCCAGGACTTTATTGAG
AATCTGTTACAGCGGGTAGAACTGGCGGAGAAGCAGCTTGAGTACTATCAGAGCCAGCAGGCCTCTGGC
TTTGTCCGTGATCTCAGCGGGCACGTGAGCTGGAAAGGTGCTGGCGAAGCTCGCCTGGTGTGCCAAAAT
GACCTGGAATTGGAGGAGTCTGCGATTGTGGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_199450
Insert Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_199450.2
RefSeq Size 1726 bp
RefSeq ORF 1002 bp
Locus ID 22891
UniProt ID Q70YC5
MW 38.2 kDa
Gene Summary This gene encodes a zinc finger protein that may play a role in the repair of DNA damage and maintenance of genome stability. The N-terminal C2H2 zinc finger motif is required to form a protein complex with PARP1 and MRE11, which are known to be involved in the restart of stalled DNA replication forks. A mutation in this gene may be associated with breast cancer susceptibility. [provided by RefSeq, Mar 2020]
Transcript Variant: This variant (B) differs in the 3' coding region and UTR compared to variant C. The resulting protein (isoform B) is shorter and has a distinct C-terminus compared to isoform C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...