PRB1 (NM_199353) Human Untagged Clone

CAT#: SC307952

PRB1 (untagged)-Human proline-rich protein BstNI subfamily 1 (PRB1), transcript variant 2



  "NM_199353" in other vectors (2)

CNY 3,990.00


货期*
详询

规格
    • 10 ug

Product images

经常一起买 (4)
PRB1 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PM; PMF; PMS; PRB1L; PRB1M
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_199353, the custom clone sequence may differ by one or more nucleotides
ATGCTGTTGATTCTGCTGTCAGTGGCCTTGCTGGCCCTGAGCTCAGCTCAGAACTTAAAT
GAAGATGTCAGCCAGGAAGAATCTCCCTCCCTAATAGCAGGAAATCCACAAGGACCATCC
CCACAAGGAGGCAACAAGCCCCAGGGCCCCCCACCTCCTCCAGGAAAGCCACAAGGACCA
CCCCCACAAGGAGGCAACAAACCTCAAGGTCCCCCACCTCCAGGAAAGCCACAAGGACCA
CCCCCACAAGGGGACAAGTCCCGAAGTCCCCGATCTCCTCCAGGAAAACCACAAGGACCA
CCCCCACAAGGAGGAAAGCCACAAGGACCACCCCCACAAGGAGGCAACAAACCTCAAGGT
CCCCCACCTCCAGGAAAGCCACAAGGACCACCCGCACAAGGAGGCAGCAAGTCCCAAAGT
GCCCGATCTCCTCCAGGAAAGCCACAAGGACCACCCCAACAAGAAGGCAACAATCCTCAA
GGTCCCCCACCTCCAGCAGGAGGCAATCCCCAGCAGCCTCAGGCACCTCCTGCTGGACAG
CCCCAGGGACCACCACGCCCTCCTCAAGGGGGCAGACCTTCCAGACCTCCCCAGTGA
Restriction Sites Please inquire     
ACCN NM_199353
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_199353.1, NP_955385.1
RefSeq Size 774 bp
RefSeq ORF 774 bp
Locus ID 5542
UniProt ID P04280
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats have been identified. The reference genome encodes the "Medium" allele. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (2) lacks an in-frame segment within the coding region compared to variant 1. The resulting isoform (2) lacks an internal region, as compared to isoform 1. This isoform (2) may undergo proteolytic processing similar to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...