United States
Germany
Japan
United Kingdom
China
SFT2B (SFT2D2) (NM_199344) Human Untagged Clone
CAT＃: SC307944
SFT2D2 (untagged)-Human SFT2 domain containing 2 (SFT2D2)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | dJ747L4.C1.2; UNQ512 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene ORF sequence for NM_199344 edited
ATGGACAAGCTGAAGAAGGTGCTGAGCGGGCAGGACACGGAGGACCGGAGCGGCCTGTCC GAGGTTGTTGAGGCATCTTCATTAAGCTGGAGTACCAGGATAAAAGGCTTCATTGCGTGT TTTGCTATAGGAATTCTCTGCTCACTGCTGGGTACTGTTCTGCTGTGGGTGCCCAGGAAG GGACTACACCTCTTCGCAGTGTTTTATACCTTTGGTAATATCGCATCAATTGGGAGTACC ATCTTCCTCATGGGACCAGTGAAACAGCTGAAGCGAATGTTTGAGCCTACTCGTTTGATT GCAACTATCATGGTGCTGTTGTGTTTTGCACTTACCCTGTGTTCTGCCTTTTGGTGGCAT AACAAGGGACTTGCACTTATCTTCTGCATTTTGCAGTCTTTGGCATTGACGTGGTACAGC CTTTCCTTCATACCATTTGCAAGGGATGCTGTGAAGAAGTGTTTTGCCGTGTGTCTTGCA TAA |
| Restriction Sites | Please inquire |
| ACCN | NM_199344 |
| Insert Size | 500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_199344.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_199344.1, NP_955376.1 |
| RefSeq Size | 1155 bp |
| RefSeq ORF | 483 bp |
| Locus ID | 375035 |
| UniProt ID | O95562 |
| Protein Families | Transmembrane |
| Gene Summary | May be involved in fusion of retrograde transport vesicles derived from an endocytic compartment with the Golgi complex.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209667 | SFT2D2 (Myc-DDK-tagged)-Human SFT2 domain containing 2 (SFT2D2) |
CNY 1,200.00 |
|
| RC209667L1 | Lenti ORF clone of Human SFT2 domain containing 2 (SFT2D2), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC209667L2 | Lenti ORF clone of Human SFT2 domain containing 2 (SFT2D2), mGFP tagged |
CNY 5,890.00 |
|
| RC209667L3 | Lenti ORF clone of Human SFT2 domain containing 2 (SFT2D2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC209667L4 | Lenti ORF clone of Human SFT2 domain containing 2 (SFT2D2), mGFP tagged |
CNY 5,890.00 |
|
| RG209667 | SFT2D2 (tGFP-tagged) - Human SFT2 domain containing 2 (SFT2D2) |
CNY 4,370.00 |
