United States
Germany
Japan
United Kingdom
China
Stella (DPPA3) (NM_199286) Human Untagged Clone
CAT＃: SC307921
DPPA3 (untagged)-Human developmental pluripotency associated 3 (DPPA3)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Pgc7; STELLA |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_199286 edited
GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGGACCCATCACAGTTTAATCCAAC CTACATCCCAGGGTCTCCACAAATGCTCACCGAAGAAAATTCCCGGGACGATTCAGGGGC CTCTCAAATCTCCTCCGAGACGTTGATAAAGAACCTTAGTAACTTGACTATCAACGCTAG TAGCGAATCTGTTTCCCCTCTATCGGAAGCTTTACTCCGTCGAGAGTCTGTAGGAGCAGC AGTCCTCAGGGAAATCGAAGATGAGTGGCTTTACAGCAGGAGAGGAGTAAGAACATTGCT GTCTGTGCAGAGAGAAAAGATGGCAAGATTGAGATACATGTTACTCGGCGGAGTTCGTAC GCATGAAAGAAGACCAACAAACAAGGAGCCTAAGGGAGTTAAGAAGGAATCAAGACCATT CAAATGTCCCTGCAGTTTCTGCGTGTCTAATGGATGGGATCCTTCTGAGAATGCTAGAAT AGGGAATCAAGACACCAAGCCACTTCAGCCATAGGGCCTCAT |
| Restriction Sites | Please inquire |
| ACCN | NM_199286 |
| Insert Size | 500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_199286.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_199286.2, NP_954980.1 |
| RefSeq Size | 1040 bp |
| RefSeq ORF | 480 bp |
| Locus ID | 359787 |
| UniProt ID | Q6W0C5 |
| Gene Summary | This gene encodes a protein that in mice may function as a maternal factor during the preimplantation stage of development. In mice, this gene may play a role in transcriptional repression, cell division, and maintenance of cell pluripotentiality. In humans, related intronless loci are located on chromosomes 14 and X. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214676 | DPPA3 (Myc-DDK-tagged)-Human developmental pluripotency associated 3 (DPPA3) |
CNY 1,200.00 |
|
| RC214676L1 | Lenti ORF clone of Human developmental pluripotency associated 3 (DPPA3), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC214676L2 | Lenti ORF clone of Human developmental pluripotency associated 3 (DPPA3), mGFP tagged |
CNY 5,890.00 |
|
| RC214676L3 | Lenti ORF clone of Human developmental pluripotency associated 3 (DPPA3), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC214676L4 | Lenti ORF clone of Human developmental pluripotency associated 3 (DPPA3), mGFP tagged |
CNY 3,600.00 |
|
| RG214676 | DPPA3 (tGFP-tagged) - Human developmental pluripotency associated 3 (DPPA3) |
CNY 2,800.00 |
