United States
Germany
Japan
United Kingdom
China
RCL (DNPH1) (NM_199184) Human Untagged Clone
CAT＃: SC307891
DNPH1 (untagged)-Human chromosome 6 open reading frame 108 (C6orf108), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C6orf108; dJ330M21.3; RCL |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307891 representing NM_199184.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGAGCTGGGAGCGCGGGGAGCCTGGCCGCCCGGCCCTG TACTTCTGCGGGAGCATTCGCGGCGGACGCGAGGACAGGACGCTGTACGAGCGGATCGTGTCTCGGCTG CGGCGATTCGGGACAGTGCTCACCGAGCACGTGGCGGCCGCCGAGCTGGGCGCGCGCGGGGAAGAGGCT GCTGGGGGTGACAGGCTCATCCATGAGCAGGACCTGGAGTGGCTGCAGCAGGCGGACGTGGTCGTGGCA GAAGTGACACAGCCATCCTTGGGTGTAGGCTATGAGCTGGGCCGGGCCGTGGCCTTTAACAAGCGGATC CTGTGCCTGTTCCGCCCGCAGTCTGGCCGCGGTGAGCACCCCAAGCCTCCCTCCTGGCTTTCTATGGAC CCAGCCCTCAGCTCCTTCCCTGGTGGGCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_199184 |
| Insert Size | 447 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_199184.1 |
| RefSeq Size | 813 bp |
| RefSeq ORF | 447 bp |
| Locus ID | 10591 |
| UniProt ID | O43598 |
| MW | 16.2 kDa |
| Gene Summary | This gene was identified on the basis of its stimulation by c-Myc protein. The latter is a transcription factor that participates in the regulation of cell proliferation, differentiation, and apoptosis. The exact function of this gene is not known but studies in rat suggest a role in cellular proliferation and c-Myc-mediated transformation. Two alternative transcripts encoding different proteins have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) includes an additional segment in the 3' coding region, compared to variant 1, that causes a frameshift. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212506 | DNPH1 (Myc-DDK-tagged)-Human chromosome 6 open reading frame 108 (C6orf108), transcript variant 2 |
CNY 1,200.00 |
|
| RC212506L3 | Lenti ORF clone of Human chromosome 6 open reading frame 108 (C6orf108), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC212506L4 | Lenti ORF clone of Human chromosome 6 open reading frame 108 (C6orf108), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG212506 | DNPH1 (tGFP-tagged) - Human chromosome 6 open reading frame 108 (C6orf108), transcript variant 2 |
CNY 4,370.00 |
