NDUF3 (NDUFAF3) (NM_199070) Human Untagged Clone

CAT#: SC307858

NDUFAF3 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3 (NDUFAF3), nuclear gene encoding mitochondrial protein, transcript variant 2



  "NM_199070" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
NDUFAF3 Antibody - N-terminal
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 2P1; C3orf60; E3-3; MC1DN18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307858 representing NM_199070.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTACATCGACAGCTACAACAGCCGCGGCTTCATGATAAACGGAAACCGCGTGCTCGGCCCCTGCGCT
CTGCTCCCGCACTCGGTGGTGCAGTGGAACGTGGGATCCCACCAGGACATCACCGAAGACAGCTTTTCC
CTCTTCTGGTTGCTGGAGCCCCGGATAGAGATCGTGGTGGTGGGGACTGGAGACCGGACCGAGAGGCTG
CAGTCCCAGGTGCTTCAAGCCATGAGGCAGCGGGGCATTGCTGTGGAAGTGCAGGACACGCCCAATGCC
TGTGCCACCTTCAACTTCCTGTGTCATGAAGGCCGAGTAACTGGAGCTGCTCTCATCCCTCCACCAGGA
GGGACTTCACTTACATCTTTGGGCCAAGCTGCTCAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_199070
Insert Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_199070.1
RefSeq Size 950 bp
RefSeq ORF 384 bp
Locus ID 25915
MW 13.8 kDa
Gene Summary This gene encodes a mitochondrial complex I assembly protein that interacts with complex I subunits. Mutations in this gene cause mitochondrial complex I deficiency, a fatal neonatal disorder of the oxidative phosphorylation system. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2, 3 and 4 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...