United States
Germany
Japan
United Kingdom
China
TSPAN3 (NM_198902) Human Untagged Clone
CAT＃: SC307808
TSPAN3 (untagged)-Human tetraspanin 3 (TSPAN3), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TM4-A; TM4SF8; TSPAN-3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_198902, the custom clone sequence may differ by one or more nucleotides
ATGGGCCAGTGCGGCATCACCTCCTCCAAGACCGTGCTGGTCTTTCTCAACCTCATCTTC TGGGGGGCAGCTGGCATTTTATGCTATGTGGGAGCCTATGTCTTCATCACTTATGATGAC TATGACCACTTCTTTGAAGATGTGTACACGCTCATCCCTGCTGTAGTGATCATAGCTGTA GGAGCCCTGCTTTTCATCATTGGGCTAATTGGCTGCTGTGCCACAATCCGGGAAAGTCGC TGTGGACTTGCCACGGTGGAAAATGAGGTTGATCGCAGCATTCAGAAAGTGTATAAGACC TACAATGGAACCAACCCTGATGCTGCTAGCCGGGCTATTGATTATGTACAGAGACAGCTG CATTGTTGTGGAATTCACAACTACTCAGACTGGGAAAATACAGATTGGTTCAAAGAAACC AAAAACCAGAGTGTCCCTCTTAGCTGCTGCAGAGAGACTGCCAGCAATTGTAATGGCAGC CTGGCCCACCCTTCCGACCTCTATGCTGAGGGGTGTGAGGCTCTAGTAGTGAAGAAGCTA CAAGAAATCATGATGCATGTGATCTGGGCCGCACTGGCATTTGCAGCTATTCAGCTGCTG GGCATGCTGTGTGCTTGCATCGTGTTGTGCAGAAGGAGTAGAGATCCTGCTTACGAGCTC CTCATCACTGGCGGAACCTATGCATAG |
| Restriction Sites | Please inquire |
| ACCN | NM_198902 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_198902.1, NP_944492.1 |
| RefSeq Size | 1767 bp |
| RefSeq ORF | 687 bp |
| Locus ID | 10099 |
| UniProt ID | O60637 |
| Protein Families | Transmembrane |
| Gene Summary | The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. Multiple alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223157 | TSPAN3 (Myc-DDK-tagged)-Human tetraspanin 3 (TSPAN3), transcript variant 2 |
CNY 3,990.00 |
|
| RC223157L3 | Lenti-ORF clone of TSPAN3 (Myc-DDK-tagged)-Human tetraspanin 3 (TSPAN3), transcript variant 2 |
CNY 5,890.00 |
|
| RC223157L4 | Lenti-ORF clone of TSPAN3 (mGFP-tagged)-Human tetraspanin 3 (TSPAN3), transcript variant 2 |
CNY 5,890.00 |
|
| RG223157 | TSPAN3 (tGFP-tagged) - Human tetraspanin 3 (TSPAN3), transcript variant 2 |
CNY 4,370.00 |
