REG3G (NM_198448) Human Untagged Clone
CAT#: SC307699
REG3G (untagged)-Human regenerating islet-derived 3 gamma (REG3G), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LPPM429; PAP-1B; PAP1B; PAP IB; PAPIB; REG-III; REG III; UNQ429 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307699 representing NM_198448.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGCCTCCCATGGCCCTGCCCAGTGTGTCCTGGATGCTGCTTTCCTGCCTCATTCTCCTGTGTCAG GTTCAAGGTGAAGAAACCCAGAAGGAACTGCCCTCTCCACGGATCAGCTGTCCCAAAGGCTCCAAGGCC TATGGCTCCCCCTGCTATGCCTTGTTTTTGTCACCAAAATCCTGGATGGATGCAGATCTGGCTTGCCAG AAGCGGCCCTCTGGAAAACTGGTGTCTGTGCTCAGTGGGGCTGAGGGATCCTTCGTGTCCTCCCTGGTG AGGAGCATTAGTAACAGCTATTCATACATCTGGATTGGGCTCCATGACCCCACACAGGGCTCTGAGCCT GATGGAGATGGATGGGAGTGGAGTAGCACTGATGTGATGAATTACTTTGCATGGGAGAAAAATCCCTCC ACCATCTTAAACCCTGGCCACTGTGGGAGCCTGTCAAGAAGCACAGGATTTCTGAAGTGGAAAGATTAT AACTGTGATGCAAAGTTACCCTATGTCTGCAAGTTCAAGGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_198448 |
Insert Size | 528 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_198448.3 |
RefSeq Size | 855 bp |
RefSeq ORF | 528 bp |
Locus ID | 130120 |
UniProt ID | Q6UW15 |
Protein Families | Secreted Protein |
MW | 19.3 kDa |
Gene Summary | This gene encodes a member of the regenerating islet-derived genes (REG)3 protein family. These proteins are secreted, C-type lectins with a carbohydrate recognition domain and N-terminal signal peptide. The protein encoded by this gene is an antimicrobial lectin with activity against Gram-positive bacteria. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223686 | REG3G (Myc-DDK-tagged)-Human regenerating islet-derived 3 gamma (REG3G), transcript variant 2 |
CNY 2,400.00 |
|
RC223686L1 | Lenti ORF clone of Human regenerating islet-derived 3 gamma (REG3G), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC223686L2 | Lenti ORF clone of Human regenerating islet-derived 3 gamma (REG3G), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC223686L3 | Lenti ORF clone of Human regenerating islet-derived 3 gamma (REG3G), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC223686L4 | Lenti ORF clone of Human regenerating islet-derived 3 gamma (REG3G), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG223686 | REG3G (tGFP-tagged) - Human regenerating islet-derived 3 gamma (REG3G), transcript variant 2 |
CNY 4,000.00 |