United States
Germany
Japan
United Kingdom
China
CCN6 (NM_198239) Human Untagged Clone
CAT＃: SC307654
WISP3 (untagged)-Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 3
CNY 7,220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | LIBC; PPAC; PPD; PPRD; WISP-3; WISP3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_198239, the custom clone sequence may differ by one or more nucleotides
ATGAACAAGCGGCGACTTCTCTACCCCTCAGGGTGGCTCCACGGTCCCAGCGACATGCAG GGGCTCCTCTTCTCCACTCTTCTGCTTGCTGGCCTGGCACAGTTCTGCTGCAGGGTACAG GGCACTGGACCATTAGATACAACACCTGAAGGAAGGCCTGGAGAAGTGTCAGATGCACCT CAGCGTAAACAGTTTTGTCACTGGCCCTGCAAATGCCCTCAGCAGAAGCCCCGTTGCCCT CCTGGAGTGAGCCTGGTGAGAGATGGCTGTGGATGCTGTAAAATCTGTGCCAAGCAACCA GGGGAAATCTGCAATGAAGCTGACCTCTGTGACCCACACAAAGGGCTGTATTGTGACTAC TCAGTAGACAGGCCTAGGTACGAGACTGGAGTGTGTGCATACCTTGTAGCTGTTGGGTGC GAGTTCAACCAGGTACATTATCATAATGGCCAAGTGTTTCAGCCCAACCCCTTGTTCAGC TGCCTCTGTGTGAGTGGGGCCATTGGATGCACACCTCTGTTCATACCAAAGCTGGCTGGC AGTCACTGCTCTGGAGCTAAAGGTGGAAAGAAGTCTGATCAGTCAAACTGTAGCCTGGAA CCATTACTACAGCAGCTTTCAACAAGCTACAAAACAATGCCAGCTTATAGAAATCTCCCA CTTATTTGGAAAAAAAAATGTCTTGTGCAAGCAACAAAATGGACTCCCTGCTCCAGAACA TGTGGGATGGGAATATCTAACAGGGTGACCAATGAAAACAGCAACTGTGAAATGAGAAAA GAGAAAAGACTGTGTTACATTCAGCCTTGCGACAGCAATATATTAAAGACAATAAAGATT CCCAAAGGAAAAACATGCCAACCTACTTTCCAACTCTCCAAAGCTGAAAAATTTGTCTTT TCTGGATGCTCAAGTACTCAGAGTTACAAACCCACTTTTTGTGGAATATGCTTGGATAAG AGATGCTGTATCCCTAATAAGTCTAAAATGATTACTATTCAATTTGATTGCCCAAATGAG GGGTCATTTAAATGGAAGATGCTGTGGATTACATCTTGTGTGTGTCAGAGAAACTGCAGA GAACCTGGAGATATATTTTCTGAGCTCAAGATTCTGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_198239 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_198239.1, NP_937882.1 |
| RefSeq Size | 1332 bp |
| RefSeq ORF | 1119 bp |
| Locus ID | 8838 |
| UniProt ID | O95389 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
| Gene Summary | This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) represents the longer transcript and encodes the longer isoform (3). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218034 | WISP3 (Myc-DDK-tagged)-Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 3 |
CNY 3,990.00 |
|
| RC218034L3 | Lenti-ORF clone of WISP3 (Myc-DDK-tagged)-Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 3 |
CNY 5,890.00 |
|
| RC218034L4 | Lenti-ORF clone of WISP3 (mGFP-tagged)-Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 3 |
CNY 5,890.00 |
|
| RG218034 | WISP3 (tGFP-tagged) - Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 3 |
CNY 4,370.00 |
