United States
Germany
Japan
United Kingdom
China
Dectin 1 (CLEC7A) (NM_197947) Human Untagged Clone
CAT＃: SC307610
CLEC7A (untagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 1
CNY 3,600.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_197947 edited
CTCTCAAGAACAATGGAATATCATCCTGATTTAGAAAATTTGGATGAAGATGGATATACT CAATTACACTTCGACTCTCAAAGCAATACCAGGATAGCTGTTGTTTCAGAGAAAGGATCG TGTGCTGCATCTCCTCCTTGGCGCCTCATTGCTGTAATTTTGGGAATCCTATGCTTGGTA ATACTGGTGATAGCTGTGGTCCTGGGTACCATGGCTATTTGGAGATCCAATTCAGGAAGC AACACATTGGAGAATGGCTACTTTCTATCAAGAAATAAAGAGAACCACAGTCAACCCACA CAATCATCTTTAGAAGACAGTGTGACTCCTACCAAAGCTGTCAAAACCACAGGGGTTCTT TCCAGCCCTTGTCCTCCTAATTGGATTATATATGAGAAGAGCTGTTATCTATTCAGCATG TCACTAAATTCCTGGGATGGAAGTAAAAGACAATGCTGGCAACTGGGCTCTAATCTCCTA AAGATAGACAGCTCAAATGAATTGGGATTTATAGTAAAACAAGTGTCTTCCCAACCTGAT AATTCATTTTGGATAGGCCTTTCTCGGCCCCAGACTGAGGTACCATGGCTCTGGGAGGAT GGATCAACATTCTCTTCTAACTTATTTCAGATCAGAACCACAGCTACCCAAGAAAACCCA TCTCCAAATTGTGTATGGATTCACGTGTCAGTCATTTATGACCAACTGTGTAGTGTGCCC TCATATAGTATTTGTGAGAAGAAGTTTTCAATGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_197947 |
| Insert Size | 744 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | It is not a varient. ORF exactly matches with reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_197947.1, NP_922938.1 |
| RefSeq Size | 2592 bp |
| RefSeq ORF | 744 bp |
| Locus ID | 64581 |
| UniProt ID | Q9BXN2 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variant 1 has been alternatively referred to as variant 2 and isoform a has been alternatively referred to as alpha in the literature. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Human Dectin-1 deficiency impairs macrophage-mediated defense against phaeohyphomycosis
,null,
The Journal of Clinical Investigation
,PubMed ID 36377664
[CLEC7A]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221893 | CLEC7A (Myc-DDK-tagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 1 |
CNY 3,600.00 |
|
| RC221893L1 | Lenti ORF clone of Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC221893L2 | Lenti ORF clone of Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC221893L3 | Lenti ORF clone of Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC221893L4 | Lenti ORF clone of Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
| RG221893 | CLEC7A (tGFP-tagged) - Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 1 |
CNY 5,200.00 |
其它Dectin 1产品
