LILRA5 (NM_181985) Human Untagged Clone
CAT#: SC307397
LILRA5 (untagged)-Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 2
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD85; CD85F; ILT-11; ILT11; LILRB7; LIR-9; LIR9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307397 representing NM_181985.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCACCATGGTCTCATCCATCTGCACAGCTGCAGCCAGTGGGAGGAGACGCCGTGAGCCCTGCCCTC ATGGTTCTGCTCTGCCTCGGGAACCTCTCCAAAGCCACCCTCTGGGCTGAGCCAGGCTCTGTGATCAGC CGGGGGAACTCTGTGACCATCCGGTGTCAGGGGACCCTGGAGGCCCAGGAATACCGTCTGGTTAAAGAG GGAAGCCCAGAACCCTGGGACACACAGAACCCACTGGAGCCCAAGAACAAGGCCAGATTCTCCATCCCA TCCATGACAGAGCACCATGCAGGGAGATACCGCTGTTACTACTACAGCCCTGCAGGCTGGTCAGAGCCC AGCGACCCCCTGGAGCTGGTGGTGACAGGATTCTACAACAAACCCACCCTCTCAGCCCTGCCCAGTCCT GTGGTGACCTCAGGAGAGAACGTGACCCTCCAGTGTGGCTCACGGCTGAGATTCGACAGGTTCATTCTG ACTGAGGAAGGAGACCACAAGCTCTCCTGGACCTTGGACTCACAGCTGACCCCCAGTGGGCAGTTCCAG GCCCTGTTCCCTGTGGGCCCTGTGACCCCCAGCCACAGGTGGATGCTCAGATGCTATGGCTCTCGCAGG CATATCCTGCAGGTATGGTCAGAACCCAGTGACCTCCTGGAGATTCCGGTCTCAGGAGCAGCTGATAAC CTCAGTCCGTCACAAAACAAGTCTGACTCTGGGACTGCCTCACACCTTCAGGATTACGCAGTAGAGAAT CTCATCCGCATGGGCATGGCCGGCTTGATCCTGGTGGTCCTTGGGATTCTGATATTTCAGGATTGGCAC AGCCAGAGAAGCCCCCAAGCTGCAGCTGGAAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_181985 |
Insert Size | 864 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181985.3 |
RefSeq Size | 1327 bp |
RefSeq ORF | 864 bp |
Locus ID | 353514 |
UniProt ID | A6NI73 |
MW | 31.5 kDa |
Gene Summary | The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2), also known as LIR9m2, lacks an in-frame coding segment, as compared to variant 1. The resulting isoform (2) lacks an internal region, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213883 | LILRA5 (Myc-DDK-tagged)-Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 2 |
CNY 2,400.00 |
|
RC213883L3 | Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213883L4 | Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG213883 | LILRA5 (tGFP-tagged) - Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 2 |
CNY 4,370.00 |