GPR141 (NM_181791) Human Untagged Clone
CAT#: SC307369
GPR141 (untagged)-Human G protein-coupled receptor 141 (GPR141)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PGR13 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_181791 edited
ATGCCTGGCCACAATACCTCCAGGAATTCCTCTTGCGATCCTATAGTGACACCCCACTTA ATCAGCCTCTACTTCATAGTGCTTATTGGCGGGCTGGTGGGTGTCATTTCCATTCTTTTC CTCCTGGTGAAAATGAACACCCGGTCAGTGACCACCATGGCGGTCATTAACTTGGTGGTG GTCCACAGCGTTTTTCTGCTGACAGTGCCATTTCGCTTGACCTACCTCATCAAGAAGACT TGGATGTTTGGGCTGCCCTTCTGCAAATTTGTGAGTGCCATGCTGCACATCCACATGTAC CTCACGTTCCTATTCTATGTGGTGATCCTGGTCACCAGATACCTCATCTTCTTCAAGTGC AAAGACAAAGTGGAATTCTACAGAAAACTGCATGCTGTGGCTGCCAGTGCTGGCATGTGG ACGCTGGTGATTGTCATTGTGGTACCCCTGGTTGTCTCCCGGTATGGAATCCATGAGGAA TACAATGAGGAGCACTGTTTTAAATTTCACAAAGAGCTTGCTTACACATATGTGAAAATC ATCAACTATATGATAGTCATTTTTGTCATAGCCGTTGCTGTGATTCTGTTGGTCTTCCAG GTCTTCATCATTATGTTGATGGTGCAGAAGCTACGCCACTCTTTACTATCCCACCAGGAG TTCTGGGCTCAGCTGAAAAACCTATTTTTTATAGGGGTCATCCTTGTTTGTTTCCTTCCC TACCAGTTCTTTAGGATCTATTACTTGAATGTTGTGACGCATTCCAATGCCTGTAACAGC AAGGTTGCATTTTATAACGAAATCTTCTTGAGTGTAACAGCAATTAGCTGCTATGATTTG CTTCTCTTTGTCTTTGGGGGAAGCCATTGGTTTAAGCAAAAGATAATTGGCTTATGGAAT TGTGTTTTGTGCCGTTAG |
Restriction Sites | Please inquire |
ACCN | NM_181791 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_181791.1, NP_861456.1 |
RefSeq Size | 918 bp |
RefSeq ORF | 918 bp |
Locus ID | 353345 |
UniProt ID | Q7Z602 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | GPR141 is a member of the rhodopsin family of G protein-coupled receptors (GPRs) (Fredriksson et al., 2003 [PubMed 14623098]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) and variants 2 and 3 all encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224590 | GPR141 (Myc-DDK-tagged)-Human G protein-coupled receptor 141 (GPR141) |
CNY 2,400.00 |
|
RC224590L3 | Lenti ORF clone of Human G protein-coupled receptor 141 (GPR141), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224590L4 | Lenti ORF clone of Human G protein-coupled receptor 141 (GPR141), mGFP tagged |
CNY 5,890.00 |
|
RG224590 | GPR141 (tGFP-tagged) - Human G protein-coupled receptor 141 (GPR141) |
CNY 4,000.00 |