ERAS (NM_181532) Human Untagged Clone
CAT#: SC307300
ERAS (untagged)-Human ES cell expressed Ras (ERAS)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HRAS2; HRASP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_181532 edited
CTGAGCTGCCTGCTGGGGTCATGGAGCTGCCAACAAAGCCTGGCACCTTCGACCTGGGCC TGGCCACATGGAGCCCTTCCTTCCAGGGGGAAACCCACCGGGCTCAGGCACGCCGCAGGG ATGTTGGCAGGCAGCTGCCTGAGTACAAGGCTGTGGTGGTGGGCGCCAGTGGCGTGGGCA AGAGTGCGCTGACCATCCAGCTGAACCACCAGTGCTTCGTGGAGGACCACGACCCCACCA TCCAGGATTCCTACTGGAAGGAGTTGACCCTGGACAGTGGGGACTGCATTCTGAATGTGC TGGACACAGCAGGGCAGGCCATCCATAGGGCCCTGCGTGACCAGTGCCTGGCTGTCTGTG ATGGTGTGCTGGGCGTCTTCGCTCTCGATGACCCCTCGTCTCTGATCCAGCTGCAGCAGA TATGGGCCACCTGGGGCCCTCACCCCGCCCAGCCCCTTGTCCTCGTGGGCAACAAGTGTG ACCTTGTGACCACTGCTGGAGATGCTCATGCCGCTGCTGCAGCCCTCGCACACAGCTGGG GGGCCCACTTCGTGGAGACCTCGGCCAAAACACGGCAAGGCGTGGAGGAGGCCTTTTCCC TGCTGGTCCATGAGATCCAGAGGGTCCAGGAGGCCATGGCGAAGGAGCCCATGGCAAGGT CCTGTAGGGAGAAGACCCGGCACCAGAAGGCCACCTGCCACTGTGGCTGCTCTGTGGCCT GAAGGTCTTGGCCAAGAAATGTAGACCTTTCCCCAGGCCAGGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_181532 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_181532.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181532.2, NP_853510.1 |
RefSeq Size | 1266 bp |
RefSeq ORF | 702 bp |
Locus ID | 3266 |
UniProt ID | Q7Z444 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a constitutively active member of the small GTPase Ras protein family. The encoded protein activates the phosphatidylinositol 3-kinase signal transduction pathway in undifferentiated stem cells, but is not expressed in differentiated cells. This gene may be involved in cancer and chemotherapy resistance. [provided by RefSeq, Dec 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210965 | ERAS (Myc-DDK-tagged)-Human ES cell expressed Ras (ERAS) |
CNY 2,400.00 |
|
RC210965L1 | Lenti ORF clone of Human ES cell expressed Ras (ERAS), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210965L2 | Lenti ORF clone of Human ES cell expressed Ras (ERAS), mGFP tagged |
CNY 5,890.00 |
|
RC210965L3 | Lenti ORF clone of Human ES cell expressed Ras (ERAS), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210965L4 | Lenti ORF clone of Human ES cell expressed Ras (ERAS), mGFP tagged |
CNY 4,800.00 |
|
RG210965 | ERAS (tGFP-tagged) - Human ES cell expressed Ras (ERAS) |
CNY 4,000.00 |