United States
Germany
Japan
United Kingdom
China
N acetyl transferase 5 (NAA20) (NM_181527) Human Untagged Clone
CAT＃: SC307297
NAA20 (untagged)-Human N(alpha)-acetyltransferase 20, NatB catalytic subunit (NAA20), transcript variant 2
CNY 3,990.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | dJ1002M8.1; NAT3; NAT3P; NAT5; NAT5P |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_181527, the custom clone sequence may differ by one or more nucleotides
ATGCTGTCTCAGTCATGTAACTTGGATCCACTTACAGAAACTTATGGGATTCCTTTCTAC CTACAATACCTCGCCCACTGGCCAGAGTATTTCATTGTTGCAGAGGCACCTGGTGGAGAA TTAATGGGTTATATTATGGGTAAAGCAGAAGGCTCAGTAGCTAGGGAAGAATGGCACGGG CACGTCACAGCTCTGTCTGTTGCCCCAGAATTTCGACGCCTTGGTTTGGCTGCTAAACTT ATGGAGTTACTAGAGGAGATTTCAGAAAGAAAGGGTGGATTTTTTGTGGATCTCTTTGTA AGAGTATCTAACCAAGTTGCAGTTAACATGTACAAGCAGTTGGGCTACAGTGTATATAGG ACGGTCATAGAGTACTATTCGGCCAGCAACGGGGAGCCTGATGAGGACGCTTATGATATG AGGAAAGCACTTTCCAGGGATACTGAGAAGAAATCCATCATACCATTACCTCATCCTGTG AGGCCTGAAGACATTGAATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_181527 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181527.1, NP_852668.1 |
| RefSeq Size | 1346 bp |
| RefSeq ORF | 501 bp |
| Locus ID | 51126 |
| Protein Pathways | Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism |
| Gene Summary | NAT5 is a component of N-acetyltransferase complex B (NatB). Human NatB performs cotranslational N(alpha)-terminal acetylation of methionine residues when they are followed by asparagine (Starheim et al., 2008 [PubMed 18570629]).[supplied by OMIM, Apr 2009] Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1, resulting in an isoform (b) which is shorter and has a distinct N-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222201 | NAA20 (Myc-DDK-tagged)-Human N(alpha)-acetyltransferase 20, NatB catalytic subunit (NAA20), transcript variant 2 |
CNY 3,990.00 |
|
| RC222201L3 | Lenti-ORF clone of NAA20 (Myc-DDK-tagged)-Human N(alpha)-acetyltransferase 20, NatB catalytic subunit (NAA20), transcript variant 2 |
CNY 5,890.00 |
|
| RC222201L4 | Lenti-ORF clone of NAA20 (mGFP-tagged)-Human N(alpha)-acetyltransferase 20, NatB catalytic subunit (NAA20), transcript variant 2 |
CNY 5,890.00 |
|
| RG222201 | NAA20 (tGFP-tagged) - Human N(alpha)-acetyltransferase 20, NatB catalytic subunit (NAA20), transcript variant 2 |
CNY 4,370.00 |
其它N acetyl transferase 5产品
