CMTM1 (NM_181269) Human Untagged Clone
CAT#: SC307249
CMTM1 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CKLFH; CKLFH1; CKLFSF1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_181269, the custom clone sequence may differ by one or more nucleotides
ATGGATCCTGAACACGCCAAACCTGAGTCATCCGAGGCACCTTCAGGGAACTTGAAACAA CCGGAGACTGCCGCAGCCCTGAGTCTTATCTTAGGAGCATTAGCTTGTTTCATCATCACC CAAGCCAATGAGTCATTTATAACAATCACAAGTCTGGAAATCTGCATTGTCGTTTTTTTT ATTCTAATATATGTGCTAACCCTTCACCACTTGCTGACCTATTTACATTGGCCCTTACTT GATCTTACCAACAGTATCATTACAGCTGTGTTCCTTTCAGTAGTTGCCATCTTGGCCATG CAAGAAAAGAAAAGAAGGCATTTACTCTATGTCGGGGGGTCCCTGTGTCTCACAGCGGTA ATCGTGTGTTGCATCGATGCGTTTGTGGTCACCACGAAGATGAGGACCAACTTGAAAAGA TTCCTGGGAGTCGAAGTTGAAAGGAAGCTTTCCCCCGCCAAGGACGCCTACCCCGAAACC GGCCCCGACGCCCCGCAGAGGCCCGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_181269 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_181269.1, NP_851786.1 |
RefSeq Size | 784 bp |
RefSeq ORF | 510 bp |
Locus ID | 113540 |
UniProt ID | Q8IZ96 |
Protein Families | Transmembrane |
Gene Summary | This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CKLF (chemokine-like factor).[provided by RefSeq, Feb 2011] Transcript Variant: This variant (1) lacks an alternate in-frame segment of the first coding exon, compared to variant 17. The encoded isoform (1) is shorter than the protein (isoform 13) encoded by variant 17. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219707 | CMTM1 (Myc-DDK-tagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 1 |
CNY 3,990.00 |
|
RC219707L3 | Lenti-ORF clone of CMTM1 (Myc-DDK-tagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 1 |
CNY 5,890.00 |
|
RC219707L4 | Lenti-ORF clone of CMTM1 (mGFP-tagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 1 |
CNY 5,890.00 |
|
RG219707 | CMTM1 (tGFP-tagged) - Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 1 |
CNY 4,370.00 |