United States
Germany
Japan
United Kingdom
China
CMTM4 (NM_178818) Human Untagged Clone
CAT＃: SC307223
CMTM4 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CKLFSF4 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_178818 edited
ATGCGGAGCGGCGAGGAGCTGGACGGCTTCGAGGGCGAGGCCTCGAGCACCTCCATGATC TCGGGCGCCAGCAGCCCGTACCAGCCCACCACCGAGCCGGTGAGCCAGCGCCGCGGGCTG GCCGGCCTGCGCTGCGACCCCGACTACCTGCGCGGCGCGCTCGGCCGCCTCAAGGTCGCC CAAGTGATCTTGGCCCTGATTGCATTCATCTGCATAGAGACCATCATGGCATGCTCCCCG TGTGAAGGCCTCTACTTTTTTGAGTTTGTGAGCTGCAGTGCGTTTGTGGTGACTGGCGTC TTGCTGATTATGTTCAGTCTCAACCTGCACATGAGGATCCCCCAGATCAACTGGAATCTG ACAGATTTGGTCAACACTGGACTCAGCGCTTTCCTTTTCTTTATTGCTTCAATCGTACTG GCTGCTTTAAACCATAGAGCCGGAGCAGAAATTGCTGCCGTGATATTTGGCTTCTTGGAG ACTGCGGCATATGCAGTGAACACATTCCTGGCAGTGCAGAAATGGAGAGTCAGCGTCCGC CAGCAGAGCACCAATGACTACATCCGAGCCCGCACGGAGTCCAGGGATGTGGACAGTCGC CCTGAGATCCAGCGCCTGGACACTTTTTCCTACTCCACAAACGTAACAGTAAGGAAAAAA TCACCCACAAACCTGCTGAGTTTGAATCACTGGCAACTTGCCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_178818 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_178818.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_178818.2, NP_848933.1 |
| RefSeq Size | 3430 bp |
| RefSeq ORF | 705 bp |
| Locus ID | 146223 |
| UniProt ID | Q8IZR5 |
| Protein Families | Transmembrane |
| Gene Summary | This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217697 | CMTM4 (Myc-DDK-tagged)-Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1 |
CNY 2,400.00 |
|
| RC217697L3 | Lenti ORF clone of Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217697L4 | Lenti ORF clone of Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG217697 | CMTM4 (tGFP-tagged) - Human CKLF-like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 1 |
CNY 4,370.00 |
