ARL6 (NM_177976) Human Untagged Clone

CAT#: SC307110

ARL6 (untagged)-Human ADP-ribosylation factor-like 6 (ARL6), transcript variant 2



  "NM_177976" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-ARL6 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BBS3; RP55
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307110 representing NM_177976.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGATTGCTAGACAGACTTTCAGTCTTGCTTGGCCTGAAGAAGAAGGAGGTTCATGTTTTGTGCCTT
GGGCTAGATAATAGTGGCAAAACGACGATCATTAACAAACTTAAACCTTCAAATGCTCAATCTCAAAAT
ATCCTTCCAACAATAGGATTCAGCATAGAGAAATTCAAATCATCCAGTTTGTCATTTACAGTGTTTGAC
ATGTCAGGTCAAGGAAGATACAGAAATCTCTGGGAACACTATTATAAAGAAGGCCAAGCTATTATTTTT
GTCATTGATAGTAGTGATAGATTAAGAATGGTTGTGGCCAAAGAAGAACTCGATACTCTTCTGAATCAT
CCAGATATTAAACACCGTCGAATTCCAATCTTATTCTTTGCAAATAAAATGGATCTTAGAGATGCAGTG
ACATCTGTAAAAGTGTCTCAGTTGCTGTGTTTAGAGAACATCAAAGATAAACCCTGGCATATTTGTGCT
AGTGATGCCATAAAAGGAGAAGGCTTGCAAGAAGGTGTAGACTGGCTTCAAGATCAGATCCAGACTGTG
AAGACATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_177976
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_177976.3
RefSeq Size 4313 bp
RefSeq ORF 561 bp
Locus ID 84100
UniProt ID Q9H0F7
MW 21.1 kDa
Gene Summary The protein encoded by this gene belongs to the ARF-like (ADP ribosylation factor-like) sub-family of the ARF family of GTP-binding proteins which are involved in regulation of intracellular traffic. Mutations in this gene are associated with Bardet-Biedl syndrome (BBS). A vision-specific transcript, encoding long isoform BBS3L, has been described (PMID: 20333246). [provided by RefSeq, Apr 2016]
Transcript Variant: Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...