TAS2R49 (TAS2R20) (NM_176889) Human Untagged Clone

CAT#: SC307083

TAS2R20 (untagged)-Human taste receptor, type 2, member 20 (TAS2R20)



  "NM_176889" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-TAS2R49 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms T2R20; T2R49; T2R56; TAS2R49
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307083 representing NM_176889.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGAGTTTTCTACACATTGTTTTTTCCATTCTAGTAGTGGTTGCATTTATTCTTGGAAATTTTGCC
AATGGCTTTATAGCACTGATAAATTTCATTGCCTGGGTCAAGAGACAAAAGATCTCCTCAGCTGATCAA
ATTATTGCTGCTCTGGCAGTCTCCAGAGTTGGTTTGCTCTGGGTAATATTATTACATTGGTATTCAACT
GTGTTGAATCCAACTTCATCTAATTTAAAAGTAATAATTTTTATTTCTAATGCCTGGGCAGTAACCAAT
CATTTCAGCATCTGGCTTGCTACTAGCCTCAGCATATTTTATTTGCTCAAGATCGTCAATTTCTCCAGA
CTTATTTTTCATCACTTAAAAAGGAAGGCTAAGAGTGTAGTTCTGGTGATAGTGTTGGGGTCTTTGTTC
TTTTTGGTTTGTCACCTTGTGATGAAACACACGTATATAAATGTGTGGACAGAAGAATGTGAAGGAAAC
GTAACTTGGAAGATCAAACTGAGGAATGCAATGCACCTTTCCAACTTGACTGTAGCCATGCTAGCAAAC
TTGATACCATTCACTCTGACCCTGATATCTTTTCTGCTGTTAATCTACTCTCTGTGTAAACATCTGAAG
AAGATGCAGCTCCATGGCAAAGGATCTCAAGATCCCAGCACCAAGATCCACATAAAAGCTCTGCAAACT
GTGACCTCCTTCCTCATATTACTTGCCATTTACTTTCTGTGTCTAATCATATCGTTTTGGAATTTTAAG
ATGCGACCAAAAGAAATTGTCTTAATGCTTTGCCAAGCTTTTGGAATCATATATCCATCATTCCACTCA
TTCATTCTGATTTGGGGGAACAAGACGCTAAAGCAGACCTTTCTTTCAGTTTTGTGGCAGGTGACTTGC
TGGGCAAAAGGACAGAACCAGTCAACTCCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_176889
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_176889.3
RefSeq Size 2343 bp
RefSeq ORF 930 bp
Locus ID 259295
UniProt ID P59543
Protein Families Transmembrane
Protein Pathways Taste transduction
MW 35.4 kDa
Gene Summary This gene encodes a member of the taste receptor two family of class C G-protein coupled receptors. Receptors of this family have a short extracellular N-terminus, seven transmembrane helices, three extracellular loops and three intracellular loops, and an intracellular C-terminus. Members of this family are expressed in a subset of taste receptor cells, where they function in bitter taste reception, as well as in non-gustatory cells including those of the brain, reproductive organs, respiratory system, and gastrointestinal system. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...