Zinc transporter 8 (SLC30A8) (NM_173851) Human Untagged Clone
CAT#: SC306942
SLC30A8 (untagged)-Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 1
CNY 5,488.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ZnT-8; ZNT8 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_173851 edited
TTTGCTTCCAAAACTGGGCAGTGAGTTCAACAACAACGACAACAACAGCCGCAGCTCATC CTGGCCGTCATGGAGTTTCTTGAAAGAACGTATCTTGTGAATGATAAAGCTGCCAAGATG TATGCTTTCACACTAGAAAGTGTGGAACTCCAACAGAAACCGGTGAATAAAGATCAGTGT CCCAGAGAGAGACCAGAGGAGCTGGAGTCAGGAGGCATGTACCACTGCCACAGTGGCTCC AAGCCCACAGAAAAGGGGGCGAATGAGTACGCCTATGCCAAGTGGAAACTCTGTTCTGCT TCAGCAATATGCTTCATTTTCATGATTGCAGAGGTCGTGGGTGGGCACATTGCTGGGAGT CTTGCTGTTGTCACAGATGCTGCCCACCTCTTAATTGACCTGACCAGTTTCCTGCTCAGT CTCTTCTCCCTGTGGTTGTCATCGAAGCCTCCCTCTAAGCGGCTGACATTTGGATGGCAC CGAGCAGAGATCCTTGGTGCCCTGCTCTCCATCCTGTGCATCTGGGTGGTGACTGGCGTG CTAGTGTACCTGGCATGTGAGCGCCTGCTGTATCCTGATTACCAGATCCAGGCGACTGTG ATGATCATCGTTTCCAGCTGCGCAGTGGCGGCCAACATTGTACTAACTGTGGTTTTGCAC CAGAGATGCCTTGGCCACAATCACAAGGAAGTACAAGCCAATGCCAGCGTCAGAGCTGCT TTTGTGCATGCCCTTGGAGATCTATTTCAGAGTATCAGTGTGCTAATTAGTGCACTTATT ATCTACTTTAAGCCAGAGTATAAAATAGCCGACCCAATCTGCACATTCATCTTTTCCATC CTGGTCTTGGCCAGCACCATCACTATCTTAAAGGACTTCTCCATCTTACTCATGGAAGGT GTGCCAAAGAGCCTGAATTACAGTGGTGTGAAAGAGCTTATTTTAGCAGTCGACGGGGTG CTGTCTGTGCACAGCCTGCACATCTGGTCTCTAACAATGAATCAAGTAATTCTCTCAGCT CATGTTGCTACAGCAGCCAGCCGGGACAGCCAAGTGGTTCGGAGAGAAATTGCTAAAGCC CTTAGCAAAAGCTTTACGATGCACTCACTCACCATTCAGATGGAATCTCCAGTTGACCAG GACCCCGACTGCCTTTTCTGTGAAGACCCCTGTGACTAGCTCAGTCACACCGTCAGTTTC CCAAATTTGACAGGCCACCTTCAAACATGCTGC |
Restriction Sites | Please inquire |
ACCN | NM_173851 |
Insert Size | 1300 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_173851.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173851.2, NP_776250.2 |
RefSeq Size | 5373 bp |
RefSeq ORF | 1110 bp |
Locus ID | 169026 |
UniProt ID | Q8IWU4 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a zinc efflux transporter involved in the accumulation of zinc in intracellular vesicles. This gene is expressed at a high level only in the pancreas, particularly in islets of Langerhans. The encoded protein colocalizes with insulin in the secretory pathway granules of the insulin-secreting INS-1 cells. Allelic variants of this gene exist that confer susceptibility to diabetes mellitus, noninsulin-dependent (NIDDM). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010] Transcript Variant: This variant (1) encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
A fluorescence sedimentation assay for dsDNA antibodies
,Duus, K;Draborg, AH;Güven, E;Moreno, YM;Jacobsen, S;Nielsen, CT;Houen, G;,
Scand. J. Clin. Lab. Invest.
,PubMed ID 28678535
[SLC30A8]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220964 | SLC30A8 (Myc-DDK-tagged)-Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 1 |
CNY 5,488.00 |
|
RC220964L1 | Lenti ORF clone of Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC220964L2 | Lenti ORF clone of Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC220964L3 | Lenti ORF clone of Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC220964L4 | Lenti ORF clone of Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RG220964 | SLC30A8 (tGFP-tagged) - Human solute carrier family 30 (zinc transporter), member 8 (SLC30A8), transcript variant 1 |
CNY 7,088.00 |
其它Zinc transporter 8产品