G CSF (CSF3) (NM_172219) Human Untagged Clone
CAT#: SC306744
CSF3 (untagged)-Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C17orf33; CSF3OS; GCSF |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_172219 edited
CATGGCTGGACCTGCCACCCAGAGCCCCATGAAGCTGATGGCCCTGCAGCTGCTGCTGTG GCATAGTGCACTCTGGACAGTGCAGGAAGCCACCCCCCTGGGCCCTGCCAGCTCCCTGCC CCAGAGCTTCCTGCTCAAGTGCTTAGAGCAAGTGAGGAAGATCCAGGGCGATGGCGCAGC GCTCCAGGAGAAGCTGTGTGCCACCTACAAGCTGTGCCACCCCGAGGAGCTGGTGCTGCT CGGACACTCTCTGGGCATCCCCTGGGCTCCCCTGAGCAGCTGCCCCAGCCAGGCCCTGCA GCTGGCAGGCTGCTTGAGCCAACTCCATAGCGGCCTTTTCCTCTACCAGGGGCTCCTGCA GGCCCTGGAAGGGATCTCCCCCGAGTTGGGTCCCACCTTGGACACACTGCAGCTGGACGT CGCCGACTTTGCCACCACCATCTGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCT GCAGCCCACCCAGGGTGCCATGCCGGCCTTCGCCTCTGCTTTCCAGCGCCGGGCAGGAGG GGTCCTGGTTGCCTCCCATCTGCAGAGCTTCCTGGAGGTGTCGTACCGCGTTCTACGCCA CCTTGCCCAGCCCTGAGCCAAGCCCTCCCCATCCCATGTATTTATCTCTATTTAATATTT ATGTCTATTTAA |
Restriction Sites | Please inquire |
ACCN | NM_172219 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_172219.1, NP_757373.1 |
RefSeq Size | 1509 bp |
RefSeq ORF | 615 bp |
Locus ID | 1440 |
UniProt ID | P09919 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
Protein Pathways | Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway |
Gene Summary | This gene encodes a member of the IL-6 superfamily of cytokines. The encoded cytokine controls the production, differentiation, and function of granulocytes. Granulocytes are a type of white blood cell that are part of the innate immune response. A modified form of this protein is commonly administered to manage chemotherapy-induced neutropenia. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2020] Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1, resulting in a shorter isoform (b). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Enhanced non-viral gene delivery by coordinated endosomal release and inhibition of ß-tubulin deactylase
,Ho, YK;Zhou, LH;Tam, KC;Too, HP;,
Nucleic Acids Res.
,PubMed ID 27899629
[CSF3]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219459 | CSF3 (Myc-DDK-tagged)-Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 2 |
CNY 3,990.00 |
|
RC219459L3 | Lenti-ORF clone of CSF3 (Myc-DDK-tagged)-Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 2 |
CNY 5,890.00 |
|
RC219459L4 | Lenti-ORF clone of CSF3 (mGFP-tagged)-Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 2 |
CNY 5,890.00 |
|
RG219459 | CSF3 (tGFP-tagged) - Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 2 |
CNY 4,370.00 |