United States
Germany
Japan
United Kingdom
China
IL29 (IFNL1) (NM_172140) Human Untagged Clone
CAT＃: SC306727
IFNL1 (untagged)-Human interleukin 29 (interferon, lambda 1) (IL29)
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IL-29; IL29 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_172140 edited
TAAAAAGCAGAGCCATGCCGCTGGGGAAGCAGTTGCGATTTAGCCATGGCTGCAGCTTGG ACCGTGGTGCTGGTGACTTTGGTGCTAGGCTTGGCCGTGGCAGGCCCTGTCCCCACTTCC AAGCCCACCACAACTGGGAAGGGCTGCCACATTGGCAGGTTCAAATCTCTGTCACCACAG GAGCTAGCGAGCTTCAAGAAGGCCAGGGACGCCTTGGAAGAGTCACTCAAGCTGAAAAAC TGGAGTTGCAGCTCTCCTGTCTTCCCCGGGAATTGGGACCTGAGGCTTCTCCAGGTGAGG GAGCGCCCTGTGGCCTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTCCTGGAGGCCGCT GCTGGCCCAGCCCTGGAGGACGTCCTAGACCAGCCCCTTCACACCCTGCACCACATCCTC TCCCAGCTCCAGGCCTGTATCCAGCCTCAGCCCACAGCAGGGCCCAGGCCCCGGGGCCGC CTCCACCACTGGCTGCACCGGCTCCAGGAGGCCCCCAAAAAGGAGTCCGCTGGCTGCCTG GAGGCATCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGAGACCTCAAATATGTGGCC GATGGGAACCTGTGTCTGAGAACGTCAACCCACCCTGAGTCCACCTGACACCCCACACCT TATTTATGCGCTGAGCCCTACTCCT |
| Restriction Sites | Please inquire |
| ACCN | NM_172140 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172140.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_172140.1, NP_742152.1 |
| RefSeq Size | 856 bp |
| RefSeq ORF | 603 bp |
| Locus ID | 282618 |
| UniProt ID | Q8IU54 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
| Gene Summary | This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 28B (IL28B) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219027 | IFNL1 (Myc-DDK-tagged)-Human interleukin 29 (interferon, lambda 1) (IL29) |
CNY 2,400.00 |
|
| RC219027L1 | Lenti ORF clone of Human interleukin 29 (interferon, lambda 1) (IL29), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC219027L2 | Lenti ORF clone of Human interleukin 29 (interferon, lambda 1) (IL29), mGFP tagged |
CNY 5,890.00 |
|
| RC219027L3 | Lenti ORF clone of Human interleukin 29 (interferon, lambda 1) (IL29), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219027L4 | Lenti ORF clone of Human interleukin 29 (interferon, lambda 1) (IL29), mGFP tagged |
CNY 5,890.00 |
|
| RG219027 | IFNL1 (tGFP-tagged) - Human interleukin 29 (interferon, lambda 1) (IL29) |
CNY 4,000.00 |
