WFDC10B (NM_172131) Human Untagged Clone
CAT#: SC306724
WFDC10B (untagged)-Human WAP four-disulfide core domain 10B (WFDC10B), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | WAP12 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_172131, the custom clone sequence may differ by one or more nucleotides
ATGGTGTCTTGTGAAAGGAGGGCAAGCAAAAGTGTAGGACAAATTTTGCTTTGGGATTTT GGTTACACCTGCAGACTATCCCACAGAAGGAGGAACAGCACTGAAATCCTTTCTCGCAAT CTTCCTGCATTGTACACAGGAATCAAGGTCTGTGAGAAGCGACCCAGCATAGATCTATGC ATCCACCACTGTTCATATTTCCAAAAGTGTGAAACAAATAAGATATGCTGTTCAGCCTTC TGTGGGAACATTTGTATGAGCATCCTATGA |
Restriction Sites | Please inquire |
ACCN | NM_172131 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_172131.2, NP_742143.1 |
RefSeq Size | 477 bp |
RefSeq ORF | 270 bp |
Locus ID | 280664 |
UniProt ID | Q8IUB3 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an internal exon and uses an upstream translation start codon, as compared to variant 1. It encodes the longer isoform (b), which lacks a signal peptide and may be an intracellular protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219558 | WFDC10B (Myc-DDK-tagged)-Human WAP four-disulfide core domain 10B (WFDC10B), transcript variant 2 |
CNY 3,990.00 |
|
RC219558L3 | Lenti-ORF clone of WFDC10B (Myc-DDK-tagged)-Human WAP four-disulfide core domain 10B (WFDC10B), transcript variant 2 |
CNY 5,890.00 |
|
RC219558L4 | Lenti-ORF clone of WFDC10B (mGFP-tagged)-Human WAP four-disulfide core domain 10B (WFDC10B), transcript variant 2 |
CNY 5,890.00 |
|
RG219558 | WFDC10B (tGFP-tagged) - Human WAP four-disulfide core domain 10B (WFDC10B), transcript variant 2 |
CNY 4,370.00 |
其它WFDC10B产品