United States
Germany
Japan
United Kingdom
China
LIGHT (TNFSF14) (NM_172014) Human Untagged Clone
CAT＃: SC306706
TNFSF14 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 14 (TNFSF14), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD258; HVEML; LIGHT; LTg |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_172014 edited
ATGGAGGAGAGTGTCGTACGGCCCTCAGTGTTTGTGGTGGATGGACAGACCGACATCCCA TTCACGAGGCTGGGACGAAGCCACCGGAGACAGTCGTGCAGTGTGGCCCGGGACGGACCT GCAGGCTCCTGGGAGCAGCTGATACAAGAGCGAAGGTCTCACGAGGTCAACCCAGCAGCG CATCTCACAGGGGCCAACTCCAGCTTGACCGGCAGCGGGGGGCCGCTGTTATGGGAGACT CAGCTGGGCCTGGCCTTCCTGAGGGGCCTCAGCTACCACGATGGGGCCCTTGTGGTCACC AAAGCTGGCTACTACTACATCTACTCCAAGGTGCAGCTGGGCGGTGTGGGCTGCCCGCTG GGCCTGGCCAGCACCATCACCCACGGCCTCTACAAGCGCACACCCCGCTACCCCGAGGAG CTGGAGCTGTTGGTCAGCCAGCAGTCACCCTGCGGACGGGCCACCAGCAGCTCCCGGGTC TGGTGGGACAGCAGCTTCCTGGGTGGTGTGGTACACCTGGAGGCTGGGGAGGAGGTGGTC GTCCGTGTGCTGGATGAACGCCTGGTTCGACTGCGTGATGGTACCCGGTCTTACTTCGGG GCTTTCATGGTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_172014 |
| Insert Size | 2500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_172014.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_172014.1, NP_742011.1 |
| RefSeq Size | 1395 bp |
| RefSeq ORF | 615 bp |
| Locus ID | 8740 |
| UniProt ID | O43557 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220370 | TNFSF14 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 14 (TNFSF14), transcript variant 2 |
CNY 3,990.00 |
|
| RC220370L3 | Lenti-ORF clone of TNFSF14 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 14 (TNFSF14), transcript variant 2 |
CNY 5,890.00 |
|
| RC220370L4 | Lenti-ORF clone of TNFSF14 (mGFP-tagged)-Human tumor necrosis factor (ligand) superfamily, member 14 (TNFSF14), transcript variant 2 |
CNY 5,890.00 |
|
| RG220370 | TNFSF14 (tGFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 14 (TNFSF14), transcript variant 2 |
CNY 4,240.00 |
