CLECL1 (NM_172004) Human Untagged Clone
CAT#: SC306703
CLECL1 (untagged)-Human C-type lectin-like 1 (CLECL1)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DCAL-1; DCAL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306703 representing NM_172004.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTTAGTAATTTCTTCCATGTCATACAAGTATTCGAGAAATCTGCTACCTTGATTAGTAAGACTGAA CACATTGGTTTTGTCATTTATTCATGGAGGAAGTCCACCACCCACTTGGGGAGCAGAAGGAAATTTGCC ATCTCAATTTACTTATCAGAAGTTTCTTTGCAGAAATATGATTGTCCCTTCAGTGGGACATCATTTGTG GTCTTCTCTCTCTTTTTGATCTGTGCAATGGCTGGAGATGTAGTCTACGCTGACATCAAAACTGTTCGG ACTTCCCCGTTAGAACTCGCGTTTCCACTTCAGAGATCTGTTTCTTTCAACTTTTCTACTGTCCATAAA TCATGTCCTGCCAAAGACTGGAAGGTGCATAAGGGAAAATGTTACTGGATTGCTGAAACTAAGAAATCT TGGAACAAAAGTCAAAATGACTGTGCCATAAACAATTCATATCTCATGGTGATTCAAGACATTACTGCT ATGGTGAGATTTAACATTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_172004 |
Insert Size | 504 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_172004.3 |
RefSeq Size | 687 bp |
RefSeq ORF | 504 bp |
Locus ID | 160365 |
UniProt ID | Q8IZS7 |
Protein Families | Druggable Genome |
MW | 19.1 kDa |
Gene Summary | This gene encodes a type II transmembrane, C-type lectin-like protein that is highly expressed on dendritic and B cells. This protein may act as a T-cell costimulatory molecule that enhances interleukin-4 production, and maybe involved in the regulation of the immune response. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210857 | CLECL1 (Myc-DDK-tagged)-Human C-type lectin-like 1 (CLECL1) |
CNY 2,400.00 |
|
RC210857L1 | Lenti ORF clone of Human C-type lectin-like 1 (CLECL1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210857L2 | Lenti ORF clone of Human C-type lectin-like 1 (CLECL1), mGFP tagged |
CNY 5,890.00 |
|
RC210857L3 | Lenti ORF clone of Human C-type lectin-like 1 (CLECL1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210857L4 | Lenti ORF clone of Human C-type lectin-like 1 (CLECL1), mGFP tagged |
CNY 5,890.00 |
|
RG210857 | CLECL1 (tGFP-tagged) - Human C-type lectin-like 1 (CLECL1) |
CNY 4,000.00 |