RNF39 (NM_170770) Human Untagged Clone

CAT#: SC306698

RNF39 (untagged)-Human ring finger protein 39 (RNF39), transcript variant 3



CNY 3,656.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
RNF39 mouse monoclonal antibody, clone OTI5E10 (formerly 5E10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HZF, HZFW, LIRF, HZFw1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_170770 edited
CTATAAAGCCTGATGTGGTGGAGAGATTTGACGAGACTGAGACTCTGGTTGAAGAGAGAG
GCAATCCCAGGAGAGGGGCGGAAAGCGGCAAAAGTTAATGCGGGAGTCGGAGAGAAGGGC
ATCTACACAGCAAGCAGCAGGGGCGGCCCGCCATCTGCGCGCTCGAAGGCGGTCACGGTG
GTCGCGGAAGGGGCGGCGTCCAGATCCTGGCTTTCCATGGATGCGCCCGAGCTGGGCCCG
GGGCTGGTGGAGCGTCTGGAGCAGCTGGCGACGTGTCCTCTGTGCGGGGGCTCCTTCGAG
GACCCGGTGCTTCTGGCGTGCGAGCACAGCTTCTGCCGCGCGTGTCTGGCCCGCCGCTGG
GGGACTCCGCCGGCGACCGGCACCGAGGCTTCCCCCACCGCCTGTCCCTGCTGCGGCCTG
CCGTGTCCCCGCCGCAGCCTGAGGTCTAATGTGCGGCTGGCGGTGGAGGTGCGAATCAGC
CGCGAGCTGCTTTTTGGGGGTGGAATTCCCCACTCATTTCTGGGAACACATTCACACGCC
CATTGCAGGAGTATTAATAGCAACCCACATTTTCGCCCCAAAATAATGAGACCTCACCTG
GTCTCCACGTTTCCACGTCCCTGCTCAAAACCAAATCCATTCCTGCCTTCTGGCTCTCAG
AATCTTCTCTCCCCTACAGCTACTACAGTACTTCCTGACTTCTCCCATTCAAACCATTCT
AGGCCTGCAATGGGGAACAGGCCCTCCCCATCAGTATTGGTAAAGTGA
Restriction Sites Please inquire     
ACCN NM_170770
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_170770.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_170770.1, NP_739576.1
RefSeq Size 1353 bp
RefSeq ORF 1353 bp
Locus ID 80352
Protein Families Druggable Genome
Gene Summary This gene lies within the major histocompatibility complex class I region on chromosome 6. Studies of a similar rat protein suggest that this gene encodes a protein that plays a role in an early phase of synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) uses alternate splice sites in the coding region which results in a frameshift and an early stop codon, compared to variant 1. Isoform 3 is shorter and has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...