CRISP1 (NM_170609) Human Untagged Clone

CAT#: SC306676

CRISP1 (untagged)-Human cysteine-rich secretory protein 1 (CRISP1), transcript variant 2



  "NM_170609" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CRISP1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AEGL1; ARP; CRISP-1; HEL-S-57; HSCRISP1D; HSCRISP1G; HUMARP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306676 representing NM_170609.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAATTAAACACCTCTTGTTTTTGGTTGCTGCTGCTTGCTTACTGCCTATGTTGTCCATGAAAAAG
AAATCAGCTAGAGACCAATTTAATAAGCTCGTCACCGACTTGCCAAATGTACAAGAAGAGATCGTTAAT
ATACACAACGCCCTCAGGAGAAGAGTAGTTCCACCAGCCAGCAACATGCTGAAGATGAGTTGGAGTGAA
GAGGCTGCACAAAATGCCAGAATTTTTTCAAAGTATTGTGATATGACAGAGAGCAACCCCCTTGAGAGG
AGACTTCCAAATACCTTTTGTGGAGAAAATATGCATATGACATCTTATCCTGTATCATGGTCAAGTGTA
ATTGGAGTCTGGTACAGTGAGTCTACAAGTTTCAAACATGGAGAATGGACAACAACGGATGATGACATA
ACTACTGACCACTACACTCAGATTGTTTGGGCCACATCTTACCTGATTGGCTGTGCCATTGCATCTTGC
CGCCAACAAGGATCACCTCGATATCTCTACGTTTGTCACTATTGTCATGACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_170609
Insert Size 537 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_170609.1
RefSeq Size 1803 bp
RefSeq ORF 537 bp
Locus ID 167
UniProt ID P54107
MW 20.5 kDa
Gene Summary Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (2) lacks an exon in the 3' coding region compared to variant 1. This results in a frame-shift, early translation termination, and a shorter isoform (2, also known as CRISP-1 delta) compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...