HOXA1 (NM_153620) Human Untagged Clone
CAT#: SC306628
HOXA1 (untagged)-Human homeobox A1 (HOXA1), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BSAS; HOX1; HOX1F |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306628 representing NM_153620.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACAATGCAAGAATGAACTCCTTCCTGGAATACCCCATACTTAGCAGTGGCGACTCGGGGACCTGC TCAGCCCGAGCCTACCCCTCGGACCATAGGATTACAACTTTCCAGTCGTGCGCGGTCAGCGCCAACAGT TGCGGCGGCGACGACCGCTTCCTAGTGGGCAGGGGGGTGCAGATCGGTTCGCCCCACCACCACCACCAC CACCACCATCACCACCCCCAGCCGGCTACCTACCAGACTTCCGGGAACCTGGGGGTGTCCTACTCCCAC TCAAGTTGTGGTCCAAGCTATGGCTCACAGAACTTCAGTGCGCCTTACAGCCCCTACGCGTTAAATCAG GAAGCAGACCCACCAAGAAGCCTGTCGCTCCCCCGCATCGGAGACATCTTCTCCAGCGCAGACTTTTGA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_153620 |
Insert Size | 414 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_153620.2 |
RefSeq Size | 2358 bp |
RefSeq ORF | 414 bp |
Locus ID | 3198 |
UniProt ID | P49639 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 14.8 kDa |
Gene Summary | In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. The encoded protein may be involved in the placement of hindbrain segments in the proper location along the anterior-posterior axis during development. Two transcript variants encoding two different isoforms have been found for this gene, with only one of the isoforms containing the homeodomain region. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate coding segment compared to variant 1, which causes a frameshift. The resulting isoform (b) has a shorter, distinct C-terminus and lacks the homeodomain region compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222721 | HOXA1 (Myc-DDK-tagged)-Human homeobox A1 (HOXA1), transcript variant 2 |
CNY 1,200.00 |
|
RC222721L1 | Lenti ORF clone of Human homeobox A1 (HOXA1), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC222721L2 | Lenti ORF clone of Human homeobox A1 (HOXA1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC222721L3 | Lenti ORF clone of Human homeobox A1 (HOXA1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222721L4 | Lenti ORF clone of Human homeobox A1 (HOXA1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG222721 | HOXA1 (tGFP-tagged) - Human homeobox A1 (HOXA1), transcript variant 2 |
CNY 2,800.00 |