ASC2 (PYDC1) (NM_152901) Human Untagged Clone
CAT#: SC306521
PYDC1 (untagged)-Human PYD (pyrin domain) containing 1 (PYDC1)
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ASC2; cPOP1; POP1; PYC1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306521 representing NM_152901.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGAACGAAGCGCGAGGCCATCCTGAAGGTGCTGGAGAACCTGACACCGGAGGAGCTCAAGAAGTTC AAGATGAAGCTGGGGACGGTGCCGCTGCGCGAGGGCTTTGAGCGCATCCCGCGGGGCGCGCTCGGGCAG CTAGATATCGTGGACCTCACCGACAAGCTGGTCGCCTCCTACTACGAGGACTACGCAGCCGAGCTCGTC GTGGCCGTGCTGCGCGACATGCGCATGTTGGAGGAGGCCGCACGGCTGCAGCGGGCTGCGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_152901 |
Insert Size | 270 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_152901.3 |
RefSeq Size | 556 bp |
RefSeq ORF | 270 bp |
Locus ID | 260434 |
UniProt ID | Q8WXC3 |
Protein Pathways | NOD-like receptor signaling pathway |
MW | 10.1 kDa |
Gene Summary | Associates with PYCARD/ASC and modulates its ability to collaborate with MEFV/pyrin and NLRP3/cryopyrin in NF-kappa-B and pro-caspase-1 activation. Suppresses kinase activity of NF-kappa-B inhibitor kinase (IKK) complex, expression of NF-kappa-B inducible genes and inhibits NF-kappa-B activation by cytokines and LPS.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211240 | PYDC1 (Myc-DDK-tagged)-Human PYD (pyrin domain) containing 1 (PYDC1) |
CNY 1,200.00 |
|
RC211240L3 | Lenti ORF clone of Human PYD (pyrin domain) containing 1 (PYDC1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211240L4 | Lenti ORF clone of Human PYD (pyrin domain) containing 1 (PYDC1), mGFP tagged |
CNY 5,890.00 |
|
RG211240 | PYDC1 (tGFP-tagged) - Human PYD (pyrin domain) containing 1 (PYDC1) |
CNY 2,800.00 |