DAND5 (NM_152654) Human Untagged Clone
CAT#: SC306475
DAND5 (untagged)-Human DAN domain family, member 5 (DAND5)
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CER2; CERL2; CKTSF1B3; COCO; CRL2; DANTE; GREM3; SP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306475 representing NM_152654.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCCTTGGCCAGCTATCCACTCTTCTGTGCCTGCTTAGCGGGGCCCTGCCTACAGGCTCAGGGAGG CCTGAACCCCAGTCTCCTCGACCTCAGTCCTGGGCTGCAGCCAATCAGACCTGGGCTCTGGGCCCAGGG GCCCTGCCCCCACTGGTGCCAGCTTCTGCCCTTGGGAGCTGGAAGGCCTTCTTGGGCCTGCAGAAAGCC AGGCAGCTGGGGATGGGCAGGCTGCAGCGTGGGCAAGACGAGGTGGCTGCTGTGACTCTGCCGCTGAAC CCTCAGGAAGTGATCCAGGGGATGTGTAAGGCTGTGCCCTTCGTTCAGGTGTTCTCCCGGCCCGGCTGC TCAGCCATACGCCTCCGAAATCATCTGTGCTTTGGTCATTGCTCCTCTCTCTACATCCCTGGCTCGGAC CCCACCCCACTAGTCCTGTGCAACAGCTGTATGCCTGCTCGCAAGCGTTGGGCACCCGTGGTCCTGTGG TGTCTCACTGGCAGCTCAGCCTCCCGTCGACGGGTGAAGATATCCACCATGCTGATCGAGGGGTGTCAC TGCAGCCCAAAAGCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_152654 |
Insert Size | 570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_152654.2 |
RefSeq Size | 1732 bp |
RefSeq ORF | 570 bp |
Locus ID | 199699 |
UniProt ID | Q8N907 |
MW | 20.2 kDa |
Gene Summary | This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to bind Nodal and to inhibit the Nodal signaling pathway which patterns left/right body asymmetry. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221703 | DAND5 (Myc-DDK-tagged)-Human DAN domain family, member 5 (DAND5) |
CNY 2,400.00 |
|
RC221703L1 | Lenti ORF clone of Human DAN domain family, member 5 (DAND5), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC221703L2 | Lenti ORF clone of Human DAN domain family, member 5 (DAND5), mGFP tagged |
CNY 5,890.00 |
|
RC221703L3 | Lenti ORF clone of Human DAN domain family, member 5 (DAND5), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221703L4 | Lenti ORF clone of Human DAN domain family, member 5 (DAND5), mGFP tagged |
CNY 5,890.00 |
|
RG221703 | DAND5 (tGFP-tagged) - Human DAN domain family, member 5 (DAND5) |
CNY 4,000.00 |