United States
Germany
Japan
United Kingdom
China
nkx6.3 (NKX6-3) (NM_152568) Human Untagged Clone
CAT＃: SC306443
NKX6 (untagged)-Human NK6 homeobox 3 (NKX6-3)
CNY 1,200.00
CNY 3,990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NKX6.3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306443 representing NM_152568.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGCAGGGGCAGCTGGCACCTGGGTCTAGGCTTTGCTCAGGGCCCTGGGGCCTCCCCGAGCTCCAA CCCGCTGCGCCCTCCTCATCAGCCGCTCAGCTGCCCTGGGGCGAGAGCTGGGGGGAAGAAGCAGACACT CCTGCATGTCTTTCTGCTTCTGGGGTGTGGTTCCAGAACCGCAGGACCAAGTGGCGGAAGAAGAGCGCC CTGGAGCCCTCGTCCTCCACGCCCCGGGCCCCGGGCGGCGCGGGTGCAGGCGCAGGCGGGGACCGCGCA CCCTCGGAGAACGAGGACGACGAGTACAACAAGCCGCTGGACCCCGACTCGGACGACGAGAAGATCCGC CTGCTGCTGCGCAAGCACCGCGCCGCCTTCTCGGTGCTCAGCCTGGGAGCGCACAGCGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_152568 |
| Insert Size | 408 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_152568.3 |
| RefSeq Size | 1683 bp |
| RefSeq ORF | 408 bp |
| Locus ID | 157848 |
| UniProt ID | A6NJ46 |
| MW | 14.3 kDa |
| Gene Summary | The NKX family of homeodomain proteins controls numerous developmental processes. Members of the NKX6 subfamily, including NKX6-3, are involved in development of the central nervous system (CNS), gastrointestinal tract, and pancreas (Alanentalo et al., 2006 [PubMed 16326147]).[supplied by OMIM, Mar 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
NKX6.3 controls gastric differentiation and tumorigenesis
,null,
Oncotarget
,PubMed ID 26314965
[NKX6-3]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215354 | NKX6 (Myc-DDK-tagged)-Human NK6 homeobox 3 (NKX6-3) |
CNY 1,200.00 |
|
| RC215354L1 | Lenti ORF clone of Human NK6 homeobox 3 (NKX6-3), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC215354L2 | Lenti ORF clone of Human NK6 homeobox 3 (NKX6-3), mGFP tagged |
CNY 5,890.00 |
|
| RC215354L3 | Lenti ORF clone of Human NK6 homeobox 3 (NKX6-3), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215354L4 | Lenti ORF clone of Human NK6 homeobox 3 (NKX6-3), mGFP tagged |
CNY 5,890.00 |
|
| RG215354 | NKX6 (tGFP-tagged) - Human NK6 homeobox 3 (NKX6-3) |
CNY 2,800.00 |
