United States
Germany
Japan
United Kingdom
China
CCDC108 (CFAP65) (NM_152389) Human Untagged Clone
CAT＃: SC306385
CCDC108 (untagged)-Human coiled-coil domain containing 108 (CCDC108), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CCDC108; SPGF40 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306385 representing NM_152389.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATGCTCACCCAGGCTCCAAGCTCCGTCGTGAGGTCCAGGAACAGCAGGAACCACACCGTGAACTCT GGTGGATCCTGCCTGAGTGCCAGCACAGTGGCCATCCCTGCCATCAACGACAGCAGTGCAGCCATGAGT GCCTGCAGCACCATCAGCGCCCAGCCCGCAAGCTCCATGGACACTCAGATGCACTCCCCAAAGAAGCAG GAGAGAGTGAACAAGAGGGTCATCTGGGGCATTGAGGTGGCTGAGGAGCTGCATTGGAAAGGCTGGGAG CTAGGAAAGGAGACCACAAGGAATCTGGTTCTGAAAAATCGATCCTTGAAACTCCAGAAGATGAAGTAC AGGTACCAGTATAAGGGATCAAGGACCCAGTGCCACAGCCTTGAGCCCCGAAAGCAGGCTCTCTTCAAA ACAAAACAAAACAAACAAAAAAAACCTTTAACATGCCATATAAAAGCCAGTGAGTGTTTAAAATACGTG CAGTATGAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_152389 |
| Insert Size | 495 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_152389.3 |
| RefSeq Size | 2318 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 255101 |
| UniProt ID | Q6ZU64 |
| Protein Families | Transmembrane |
| MW | 18.6 kDa |
| Gene Summary | The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (2) contains multiple differences in the UTRs and coding region, including the lack of multiple 3' coding exons, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (2) is shorter than isoform 1 and has a shorter N-terminus and a distinct C-terminus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224874 | CCDC108 (Myc-DDK-tagged)-Human coiled-coil domain containing 108 (CCDC108), transcript variant 2 |
CNY 1,200.00 |
|
| RC224874L3 | Lenti ORF clone of Human coiled-coil domain containing 108 (CCDC108), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224874L4 | Lenti ORF clone of Human coiled-coil domain containing 108 (CCDC108), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG224874 | CCDC108 (tGFP-tagged) - Human coiled-coil domain containing 108 (CCDC108), transcript variant 2 |
CNY 4,370.00 |
其它CCDC108产品
