United States
Germany
Japan
United Kingdom
China
DEFB106A (NM_152251) Human Untagged Clone
CAT＃: SC306356
DEFB106A (untagged)-Human defensin, beta 106A (DEFB106A)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BD-6; DEFB-6; DEFB106 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306356 representing NM_152251.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGACTTTCCTCTTTCTCTTTGCCGTGCTCTTCTTTCTGACCCCAGCCAAGAATGCATTTTTTGAT GAGAAATGCAACAAACTTAAAGGGACATGCAAGAACAATTGCGGGAAAAATGAAGAACTTATTGCTCTC TGCCAGAAGTCTCTGAAATGCTGTCGGACCATCCAGCCATGTGGGAGCATTATAGATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_152251 |
| Insert Size | 198 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_152251.3 |
| RefSeq Size | 325 bp |
| RefSeq ORF | 198 bp |
| Locus ID | 245909 |
| UniProt ID | Q8N104 |
| Protein Families | Secreted Protein |
| MW | 7.4 kDa |
| Gene Summary | Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 106, DEFB106A and DEFB106B, in head-to-head orientation. This gene, DEFB106A, represents the more centromeric copy. [provided by RefSeq, Oct 2014] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219477 | DEFB106A (Myc-DDK-tagged)-Human defensin, beta 106A (DEFB106A) |
CNY 1,200.00 |
|
| RC219477L3 | Lenti ORF clone of Human defensin, beta 106A (DEFB106A), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219477L4 | Lenti ORF clone of Human defensin, beta 106A (DEFB106A), mGFP tagged |
CNY 5,890.00 |
|
| RG219477 | DEFB106A (tGFP-tagged) - Human defensin, beta 106A (DEFB106A) |
CNY 2,800.00 |
其它DEFB106A产品
