CLDN19 (NM_148960) Human Untagged Clone
CAT#: SC306338
CLDN19 (untagged)-Human claudin 19 (CLDN19), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HOMG5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_148960 edited
CTGGCCATGACCAAAGCCCCTGCTGGCACCCTGGCCCAGCTCTGAGTCCTGGGACCCTCG GTCCTCTCTCCTGGGCCATGGCCAACTCAGGCCTCCAGCTCCTGGGCTACTTCTTGGCCC TGGGTGGCTGGGTGGGCATCATTGCTAGCACAGCCCTGCCACAGTGGAAGCAGTCTTCCT ACGCAGGCGACGCCATCATCACTGCCGTGGGCCTCTATGAAGGGCTCTGGATGTCCTGCG CCTCCCAGAGCACTGGGCAAGTGCAGTGCAAGCTCTACGACTCGCTGCTCGCCCTGGACG GTCACATCCAATCAGCGCGGGCCCTGATGGTGGTGGCCGTGCTCCTGGGCTTCGTGGCCA TGGTCCTCAGCGTAGTTGGCATGAAGTGTACGCGGGTGGGAGACAGCAACCCCATTGCCA AGGGCCGTGTTGCCATCGCCGGGGGAGCCCTCTTCATCCTGGCAGGCCTCTGCACTTTGA CTGCTGTCTCGTGGTATGCCACCCTGGTGACCCAGGAGTTCTTCAACCCAAGCACACCTG TCAATGCCAGGTATGAATTTGGCCCAGCCCTGTTCGTGGGCTGGGCCTCAGCTGGCCTGG CCGTGCTGGGCGGCTCCTTCCTCTGCTGCACATGCCCGGAGCCAGAGAGACCCAACAGCA GCCCACAGCCCTATCGGCCTGGACCCTCTGCTGCTGCCCGAGAACCAGTTGTTAAATTGC CCGCCTCCGCCAAGGGCCCCCTGGGTGTGTAATGTCCAGTCCCCAGCCAGGCTCTGTCCC CTGCCATACCTAGACTGTGTGTTTCATATTTTTTTGGAAAGAGAAGTGAACATCCAGCCC CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_148960 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_148960.1, NP_683763.1 |
RefSeq Size | 2859 bp |
RefSeq ORF | 675 bp |
Locus ID | 149461 |
UniProt ID | Q8N6F1 |
Protein Families | Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
Gene Summary | The product of this gene belongs to the claudin family. It plays a major role in tight junction-specific obliteration of the intercellular space, through calcium-independent cell-adhesion activity. Defects in this gene are the cause of hypomagnesemia renal with ocular involvement (HOMGO). HOMGO is a progressive renal disease characterized by primary renal magnesium wasting with hypomagnesemia, hypercalciuria and nephrocalcinosis associated with severe ocular abnormalities such as bilateral chorioretinal scars, macular colobomata, significant myopia and nystagmus. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (1) represents the shortest transcript, but encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216887 | CLDN19 (Myc-DDK-tagged)-Human claudin 19 (CLDN19), transcript variant 1 |
CNY 2,400.00 |
|
RC216887L1 | Lenti ORF clone of Human claudin 19 (CLDN19), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC216887L2 | Lenti ORF clone of Human claudin 19 (CLDN19), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC216887L3 | Lenti ORF clone of Human claudin 19 (CLDN19), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216887L4 | Lenti ORF clone of Human claudin 19 (CLDN19), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG216887 | CLDN19 (tGFP-tagged) - Human claudin 19 (CLDN19), transcript variant 1 |
CNY 4,000.00 |