Kallikrein 12 (KLK12) (NM_145895) Human Untagged Clone
CAT#: SC306289
KLK12 (untagged)-Human kallikrein-related peptidase 12 (KLK12), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KLK-L5; KLKL5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306289 representing NM_145895.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGCTCAGCATCTTTTTGCTCCTGTGTGTTCTTGGGCTCAGCCAGGCAGCCACACCGAAGATTTTC AATGGCACTGAGTGTGGGCGTAACTCACAGCCGTGGCAGGTGGGGCTGTTTGAGGGCACCAGCCTGCGC TGCGGGGGTGTCCTTATTGACCACAGGTGGGTCCTCACAGCGGCTCACTGCAGCGGCAGACCCATTCCC GGATCTGCTCCAGTGCCTCAACCTCTCCATCGTCTCCCATGCCACCTGCCATGGTGTGTATCCCGGGAG AATCACGAGCAACATGGTGTGTGCAGGCGGCGTCCCGGGGCAGGATGCCTGCCAGGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_145895 |
Insert Size | 336 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_145895.1 |
RefSeq Size | 814 bp |
RefSeq ORF | 336 bp |
Locus ID | 43849 |
UniProt ID | Q9UKR0 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
MW | 12 kDa |
Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks an exon in the coding region and uses alternate splice sites in the 3' coding region, compared to variant 1. Isoform 3 has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219330 | KLK12 (Myc-DDK-tagged)-Human kallikrein-related peptidase 12 (KLK12), transcript variant 3 |
CNY 1,200.00 |
|
RC219330L1 | Lenti ORF clone of Human kallikrein-related peptidase 12 (KLK12), transcript variant 3, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC219330L2 | Lenti ORF clone of Human kallikrein-related peptidase 12 (KLK12), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC219330L3 | Lenti ORF clone of Human kallikrein-related peptidase 12 (KLK12), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219330L4 | Lenti ORF clone of Human kallikrein-related peptidase 12 (KLK12), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG219330 | KLK12 (tGFP-tagged) - Human kallikrein-related peptidase 12 (KLK12), transcript variant 3 |
CNY 4,370.00 |
其它Kallikrein 12产品