RBFOX1 (NM_145893) Human Untagged Clone

CAT#: SC306288

RBFOX1 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 3



  "NM_145893" in other vectors (6)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RBFOX1 mouse monoclonal antibody, clone OTI4F9 (formerly 4F9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 2BP1; A2BP1; FOX-1; FOX1; HRNBP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306288 representing NM_145893.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGCGTCTCAAGGAGTTCTCCTGCATCCTTATGGCGTGCCTATGATTGTACCGGCAGCTCCTTAC
CTTCCTGGACTGATTCAGGGTAATCAGGAAGCAGCCGCTGCCCCTGACACAATGGCTCAGCCTTACGCT
TCGGCCCAGTTTGCTCCCCCGCAGAACGGTATCCCCGCGGAATACACGGCCCCTCATCCCCACCCCGCG
CCAGAGTACACAGGCCAGACCACGGTTCCCGAGCACACATTAAACCTGTACCCTCCCGCCCAGACGCAC
TCCGAGCAGAGCCCGGCGGACACGAGCGCTCAGACCGTCTCTGGCACCGCCACACAGACAGATGACGCA
GCACCGACGGATGGCCAGCCCCAGACACAACCTTCTGAAAACACGGAAAACAAGTCTCAGCCCAAGCGG
CTGCATGTCTCCAATATCCCCTTCAGGTTCCGGGATCCGGACCTCAGACAAATGTTTGGTCAATTTGGT
AAAATCTTAGATGTTGAAATTATTTTTAATGAGCGAGGCTCAAAGGGATTTGGTTTCGTAACTTTCGAA
AATAGTGCCGATGCGGACAGGGCGAGGGAGAAATTACACGGCACCGTGGTAGAGGGCCGTAAAATCGAG
GTAAATAATGCCACAGCACGTGTAATGACAAATAAAAAGACCGTCAACCCTTATACAAATGGCTGGAAA
TTGAATCCAGTTGTGGGTGCAGTCTACAGTCCCGAATTCTATGCAGGCACGGTCCTGTTGTGCCAGGCC
AACCAGGAGGGATCTTCCATGTACAGTGCCCCCAGTTCACTTGTATATACTTCTGCAATGCCAGGCTTC
CCGTATCCAGCAGCCACCGCCGCGGCCGCCTACCGAGGGGCGCACCTGCGAGGCCGCGGTCGCACCGTG
TACAACACCTTCAGGGCCGCGGCGCCCCCGCCCCCGATCCCGGCCTACGGCGGAGTAGTGTATCAAGAG
CCTGTGTATGGCAATAAATTGCTGCAGGGTGGTTATGCTGCATACCGCTACGCCCAGCCTACCCCTGCC
ACTGCCGCTGCCTACAGTGACAGAAATCAGTTCGTCTTCGTTGCAGCAGATGAAATTTCTTGTAACACC
TCTGCAGTTACGGACGAGTTTATGCTGCCGACCCCTACCACCACGCACTTGCTCCAGCCCCCACCTACG
GCGTTGGTGCCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_145893
Insert Size 1188 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145893.2
RefSeq Size 4155 bp
RefSeq ORF 1188 bp
Locus ID 54715
UniProt ID Q9NWB1
MW 42.4 kDa
Gene Summary The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (3), also known as beta, has an alternate exon in the 3' coding region, compared to variant 1. This results in a shorter isoform (3) with an alternate C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...