ASB4 (NM_145872) Human Untagged Clone

CAT#: SC306284

ASB4 (untagged)-Human ankyrin repeat and SOCS box containing 4 (ASB4), transcript variant 2



  "NM_145872" in other vectors (4)

CNY 5,700.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to ASB4 (ankyrin repeat and SOCS box-containing 4)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASB-4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306284 representing NM_145872.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACGGCACCACTGCCCCTGTCACTAAATCTGGAGCTGCCAAGTTAGTTAAGAGAAATTTCCTTGAG
GCGCTAAAGTCCAATGACTTCGGAAAATTGAAGGCTATTTTGATCCAAAGGCAAATAGATGTGGACACT
GTTTTTGAAGTCGAAGATGAGAATATGGTTTTGGCATCTTATAAACAAGGTTACTGGTTGCCTAGCTAT
AAATTGAAGTCTTCCTGGGCCACAGGCCTCCATCTCTCTGTCTTGTTTGGCCATGTGGAATGTCTTCTG
GTGCTACTGGACCACAATGCTACAATCAACTGTAGACCCAATGGGAAAACCCCTCTTCACGTGGCTTGT
GAAATGGCCAATGTGGATTGTGTTAAGATCCTCTGTGATCGTGGGGCAAAGCTCAATTGCTACTCCTTA
AGTGGACACACAGCTTTGCACTTTTGTACAACTCCAAGTTCCATTCTCTGTGCCAAGCAATTGGTTTGG
AGAGGGGCGAATGTGAACATGAAGACCAACAACCAAGATGAGGAGACGCCCTTGCACACGGCTGCCCAC
TTCGGCCTTTCGGAGCTGGTGGCCTTCTACGTGGAACACGGGGCCATAGTGGACAGCGTGAATGCCCAC
ATGGAGACCCCCCTGGCCATCGCCGCCTACTGGGCCCTCCGCTTTAAGGAGCAGGAGTACAGCACGGAG
CACCACCTGGTCTGCCGCATGCTGCTTGACTACAAAGCCGAAGTCAATGCCCGAGATGACGACTTTAAA
TCTCCCCTCCACAAGGCAGCCTGGAACTGTGACCACGTGCTCATGCACATGATGCTGGAAGCTGGCGCC
GAAGCCAATCTCATGGATATCAACGGCTGTGCTGCCATCCAGTACGTGCTGAAGGTCACCTCCGTGCGC
CCTGCTGCCCAGCCTGAGATCTGCTACCAGCTCCTGTTGAACCATGGGGCTGCCCGAATATACCCTCCA
CAGTTCCATAAGGTGAGGCTCTGCCCAGTGGTCAGCAGGTTGAGGAAGATTCAAATGGCAGCCTTGTCT
GAAATCTCCAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_145872
Insert Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145872.2
RefSeq Size 1565 bp
RefSeq ORF 1050 bp
Locus ID 51666
UniProt ID Q9Y574
Protein Families Druggable Genome
MW 38.9 kDa
Gene Summary The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but some of the full length sequences are not known. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform b which has a shorter and distinct C-terminus which lacks a SOCS box domain compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...