Glutathione Transferase zeta 1 (GSTZ1) (NM_145870) Human Untagged Clone
CAT#: SC306282
GSTZ1 (untagged)-Human glutathione transferase zeta 1 (GSTZ1), transcript variant 1
CNY 5,488.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GSTZ1-1; MAAI; MAAID; MAI |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_145870, the custom clone sequence may differ by one or more nucleotides
ATGCAGGCGGGGAAGCCCATCCTCTATTCCTATTTCCGAAGCTCCTGCTCATGGAGAGTTCGAATTGCTC TGGCCTTGAAAGGCATCGACTACGAGACGGTGCCCATCAATCTCATAAAGGATGGGGGCCAACAGTTTTC TAAGGACTTCCAGGCACTGAATCCTATGAAGCAGGTGCCAACCCTGAAGATTGATGGAATCACCATTCAC CAGTCACTGGCCATCATTGAGTATCTAGAGGAGATGCGTCCCACTCCGCGACTTCTGCCTCAGGACCCAA AGAAGAGGGCCAGCGTGCGTATGATTTCTGACCTCATCGCTGGTGGCATCCAGCCCCTGCAGAACCTGTC TGTCCTGAAGCAAGTGGGAGAGGAGATGCAGCTGACCTGGGCCCAGAACGCCATCACTTGTGGCTTTAAC GCCCTGGAGCAGATCCTACAGAGCACAGCGGGCATATACTGTGTAGGAGACGAGGTGACCATGGCTGATC TGTGCTTGGTGCCTCAGGTGGCAAATGCTGAAAGATTCAAGGTGGATCTCACCCCCTACCCTACCATCAG CTCCATCAACAAGAGGCTGCTGGTCTTGGAGGCCTTCCAGGTGTCTCACCCCTGCCGGCAGCCAGATACA CCCACTGAGCTGAGGGCCTAG |
Restriction Sites | Please inquire |
ACCN | NM_145870 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145870.1, NP_665877.1 |
RefSeq Size | 1395 bp |
RefSeq ORF | 1395 bp |
Locus ID | 2954 |
UniProt ID | O43708 |
Protein Families | Druggable Genome |
Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Tyrosine metabolism |
Gene Summary | This gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. This enzyme catalyzes the conversion of maleylacetoacetate to fumarylacetoacatate, which is one of the steps in the phenylalanine/tyrosine degradation pathway. Deficiency of a similar gene in mouse causes oxidative stress. Several transcript variants of this gene encode multiple protein isoforms. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200598 | GSTZ1 (Myc-DDK-tagged)-Human glutathione transferase zeta 1 (GSTZ1), transcript variant 1 |
CNY 3,840.00 |
|
RC200598L3 | Lenti-ORF clone of GSTZ1 (Myc-DDK-tagged)-Human glutathione transferase zeta 1 (GSTZ1), transcript variant 1 |
CNY 5,890.00 |
|
RC200598L4 | Lenti-ORF clone of GSTZ1 (mGFP-tagged)-Human glutathione transferase zeta 1 (GSTZ1), transcript variant 1 |
CNY 5,890.00 |
|
RG200598 | GSTZ1 (tGFP-tagged) - Human glutathione transferase zeta 1 (GSTZ1), transcript variant 1 |
CNY 4,370.00 |
其它Glutathione Transferase zeta 1产品