APOBEC3A (NM_145699) Human Untagged Clone

CAT#: SC306262

APOBEC3A (untagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A (APOBEC3A), transcript variant 1



  "NM_145699" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
APOBEC3A Rabbit pAb
    • 100 ul

CNY 2,640.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms A3A; ARP3; bK150C2.1; PHRBN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306262 representing NM_145699.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGCCAGCCCAGCATCCGGGCCCAGACACTTGATGGATCCACACATATTCACTTCCAACTTTAAC
AATGGCATTGGAAGGCATAAGACCTACCTGTGCTACGAAGTGGAGCGCCTGGACAATGGCACCTCGGTC
AAGATGGACCAGCACAGGGGCTTTCTACACAACCAGGCTAAGAATCTTCTCTGTGGCTTTTACGGCCGC
CATGCGGAGCTGCGCTTCTTGGACCTGGTTCCTTCTTTGCAGTTGGACCCGGCCCAGATCTACAGGGTC
ACTTGGTTCATCTCCTGGAGCCCCTGCTTCTCCTGGGGCTGTGCCGGGGAAGTGCGTGCGTTCCTTCAG
GAGAACACACACGTGAGACTGCGTATCTTCGCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAG
GCACTGCAAATGCTGCGGGATGCTGGGGCCCAAGTCTCCATCATGACCTACGATGAATTTAAGCACTGC
TGGGACACCTTTGTGGACCACCAGGGATGTCCCTTCCAGCCCTGGGATGGACTAGATGAGCACAGCCAA
GCCCTGAGTGGGAGGCTGCGGGCCATTCTCCAGAATCAGGGAAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_145699
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145699.3
RefSeq Size 1444 bp
RefSeq ORF 600 bp
Locus ID 200315
UniProt ID P31941
MW 23 kDa
Gene Summary This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. The protein encoded by this gene lacks the zinc binding activity of other family members. The protein plays a role in immunity, by restricting transmission of foreign DNA such as viruses. One mechanism of foreign DNA restriction is deamination of foreign double-stranded DNA cytidines to uridines, which leads to DNA degradation. However, other mechanisms are also thought to be involved, as anti-viral effect is not dependent on deaminase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...